ID: 1203042461

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:775010-775032
Sequence TTGGATATTCACTTCACCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203042457_1203042461 23 Left 1203042457 16_KI270728v1_random:774964-774986 CCATCACAAAGTGATTTCTCATA No data
Right 1203042461 16_KI270728v1_random:775010-775032 TTGGATATTCACTTCACCATTGG No data
1203042459_1203042461 -6 Left 1203042459 16_KI270728v1_random:774993-775015 CCTTCTAGTTTTTATCCTTGGAT No data
Right 1203042461 16_KI270728v1_random:775010-775032 TTGGATATTCACTTCACCATTGG No data
1203042456_1203042461 24 Left 1203042456 16_KI270728v1_random:774963-774985 CCCATCACAAAGTGATTTCTCAT No data
Right 1203042461 16_KI270728v1_random:775010-775032 TTGGATATTCACTTCACCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203042461 Original CRISPR TTGGATATTCACTTCACCAT TGG Intergenic