ID: 1203046186

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:826983-827005
Sequence CTTCTATCCAGTTTTTATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203046186_1203046187 7 Left 1203046186 16_KI270728v1_random:826983-827005 CCTACATAAAAACTGGATAGAAG No data
Right 1203046187 16_KI270728v1_random:827013-827035 TCAAAATGCTTTGTGATAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203046186 Original CRISPR CTTCTATCCAGTTTTTATGT AGG (reversed) Intergenic
No off target data available for this crispr