ID: 1203049449

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:861444-861466
Sequence GGAGTCTGTAGAACTTCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203049446_1203049449 8 Left 1203049446 16_KI270728v1_random:861413-861435 CCACATTCAGACTAGGGATTAGA No data
Right 1203049449 16_KI270728v1_random:861444-861466 GGAGTCTGTAGAACTTCCTCAGG No data
1203049443_1203049449 23 Left 1203049443 16_KI270728v1_random:861398-861420 CCATTATCAACATTTCCACATTC No data
Right 1203049449 16_KI270728v1_random:861444-861466 GGAGTCTGTAGAACTTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203049449 Original CRISPR GGAGTCTGTAGAACTTCCTC AGG Intergenic
No off target data available for this crispr