ID: 1203050472

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:871215-871237
Sequence GGTGAACTCAGCCAAGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203050469_1203050472 -8 Left 1203050469 16_KI270728v1_random:871200-871222 CCTGCTTCAGTGCAAGGTGAACT 0: 4
1: 0
2: 1
3: 8
4: 101
Right 1203050472 16_KI270728v1_random:871215-871237 GGTGAACTCAGCCAAGGGAGAGG No data
1203050467_1203050472 24 Left 1203050467 16_KI270728v1_random:871168-871190 CCACACTAGATGCAAGAGAGGTG No data
Right 1203050472 16_KI270728v1_random:871215-871237 GGTGAACTCAGCCAAGGGAGAGG No data
1203050464_1203050472 26 Left 1203050464 16_KI270728v1_random:871166-871188 CCCCACACTAGATGCAAGAGAGG No data
Right 1203050472 16_KI270728v1_random:871215-871237 GGTGAACTCAGCCAAGGGAGAGG No data
1203050466_1203050472 25 Left 1203050466 16_KI270728v1_random:871167-871189 CCCACACTAGATGCAAGAGAGGT No data
Right 1203050472 16_KI270728v1_random:871215-871237 GGTGAACTCAGCCAAGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203050472 Original CRISPR GGTGAACTCAGCCAAGGGAG AGG Intergenic
No off target data available for this crispr