ID: 1203052357

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:888093-888115
Sequence TGCCCACAGCTCCCCCGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203052352_1203052357 12 Left 1203052352 16_KI270728v1_random:888058-888080 CCCACATCAGTGTGAATGCTTTT No data
Right 1203052357 16_KI270728v1_random:888093-888115 TGCCCACAGCTCCCCCGGGCTGG No data
1203052353_1203052357 11 Left 1203052353 16_KI270728v1_random:888059-888081 CCACATCAGTGTGAATGCTTTTG No data
Right 1203052357 16_KI270728v1_random:888093-888115 TGCCCACAGCTCCCCCGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203052357 Original CRISPR TGCCCACAGCTCCCCCGGGC TGG Intergenic
No off target data available for this crispr