ID: 1203065411

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1012784-1012806
Sequence CCTGCTAACCAGACAGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203065411_1203065415 -5 Left 1203065411 16_KI270728v1_random:1012784-1012806 CCCTCTGCTGTCTGGTTAGCAGG No data
Right 1203065415 16_KI270728v1_random:1012802-1012824 GCAGGAGGTACAATTTGTACAGG No data
1203065411_1203065416 -1 Left 1203065411 16_KI270728v1_random:1012784-1012806 CCCTCTGCTGTCTGGTTAGCAGG No data
Right 1203065416 16_KI270728v1_random:1012806-1012828 GAGGTACAATTTGTACAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203065411 Original CRISPR CCTGCTAACCAGACAGCAGA GGG (reversed) Intergenic
No off target data available for this crispr