ID: 1203065416

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1012806-1012828
Sequence GAGGTACAATTTGTACAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203065408_1203065416 8 Left 1203065408 16_KI270728v1_random:1012775-1012797 CCAACCTTGCCCTCTGCTGTCTG No data
Right 1203065416 16_KI270728v1_random:1012806-1012828 GAGGTACAATTTGTACAGGAAGG No data
1203065410_1203065416 4 Left 1203065410 16_KI270728v1_random:1012779-1012801 CCTTGCCCTCTGCTGTCTGGTTA No data
Right 1203065416 16_KI270728v1_random:1012806-1012828 GAGGTACAATTTGTACAGGAAGG No data
1203065411_1203065416 -1 Left 1203065411 16_KI270728v1_random:1012784-1012806 CCCTCTGCTGTCTGGTTAGCAGG No data
Right 1203065416 16_KI270728v1_random:1012806-1012828 GAGGTACAATTTGTACAGGAAGG No data
1203065413_1203065416 -2 Left 1203065413 16_KI270728v1_random:1012785-1012807 CCTCTGCTGTCTGGTTAGCAGGA No data
Right 1203065416 16_KI270728v1_random:1012806-1012828 GAGGTACAATTTGTACAGGAAGG No data
1203065406_1203065416 13 Left 1203065406 16_KI270728v1_random:1012770-1012792 CCCTACCAACCTTGCCCTCTGCT No data
Right 1203065416 16_KI270728v1_random:1012806-1012828 GAGGTACAATTTGTACAGGAAGG No data
1203065404_1203065416 26 Left 1203065404 16_KI270728v1_random:1012757-1012779 CCTCTATAAAATCCCCTACCAAC No data
Right 1203065416 16_KI270728v1_random:1012806-1012828 GAGGTACAATTTGTACAGGAAGG No data
1203065405_1203065416 14 Left 1203065405 16_KI270728v1_random:1012769-1012791 CCCCTACCAACCTTGCCCTCTGC No data
Right 1203065416 16_KI270728v1_random:1012806-1012828 GAGGTACAATTTGTACAGGAAGG No data
1203065407_1203065416 12 Left 1203065407 16_KI270728v1_random:1012771-1012793 CCTACCAACCTTGCCCTCTGCTG No data
Right 1203065416 16_KI270728v1_random:1012806-1012828 GAGGTACAATTTGTACAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203065416 Original CRISPR GAGGTACAATTTGTACAGGA AGG Intergenic
No off target data available for this crispr