ID: 1203067238

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1030939-1030961
Sequence GCACGTGGCCATCAGCTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203067238_1203067241 7 Left 1203067238 16_KI270728v1_random:1030939-1030961 CCTGTGAGCTGATGGCCACGTGC No data
Right 1203067241 16_KI270728v1_random:1030969-1030991 TGCCCTGAACCCAGTAGTTAGGG No data
1203067238_1203067247 21 Left 1203067238 16_KI270728v1_random:1030939-1030961 CCTGTGAGCTGATGGCCACGTGC No data
Right 1203067247 16_KI270728v1_random:1030983-1031005 TAGTTAGGGATATACTTCATGGG No data
1203067238_1203067240 6 Left 1203067238 16_KI270728v1_random:1030939-1030961 CCTGTGAGCTGATGGCCACGTGC No data
Right 1203067240 16_KI270728v1_random:1030968-1030990 GTGCCCTGAACCCAGTAGTTAGG No data
1203067238_1203067246 20 Left 1203067238 16_KI270728v1_random:1030939-1030961 CCTGTGAGCTGATGGCCACGTGC No data
Right 1203067246 16_KI270728v1_random:1030982-1031004 GTAGTTAGGGATATACTTCATGG No data
1203067238_1203067248 28 Left 1203067238 16_KI270728v1_random:1030939-1030961 CCTGTGAGCTGATGGCCACGTGC No data
Right 1203067248 16_KI270728v1_random:1030990-1031012 GGATATACTTCATGGGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203067238 Original CRISPR GCACGTGGCCATCAGCTCAC AGG (reversed) Intergenic
No off target data available for this crispr