ID: 1203070916

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1073773-1073795
Sequence CAGCGGCGGTGGCGGCGGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203070906_1203070916 1 Left 1203070906 16_KI270728v1_random:1073749-1073771 CCACGGCGGCGGTGGGGCAAAAA No data
Right 1203070916 16_KI270728v1_random:1073773-1073795 CAGCGGCGGTGGCGGCGGGGGGG No data
1203070899_1203070916 18 Left 1203070899 16_KI270728v1_random:1073732-1073754 CCGCGGCGGGCAAAAAGCCACGG No data
Right 1203070916 16_KI270728v1_random:1073773-1073795 CAGCGGCGGTGGCGGCGGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203070916 Original CRISPR CAGCGGCGGTGGCGGCGGGG GGG Intergenic
No off target data available for this crispr