ID: 1203071545 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16_KI270728v1_random:1081075-1081097 |
| Sequence | CGAGACCATCCTGGCTAAGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1203071545_1203071549 | 8 | Left | 1203071545 | 16_KI270728v1_random:1081075-1081097 | CCATCTTAGCCAGGATGGTCTCG | No data | ||
| Right | 1203071549 | 16_KI270728v1_random:1081106-1081128 | GCCTTGTAATACGCCCGCCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1203071545 | Original CRISPR | CGAGACCATCCTGGCTAAGA TGG (reversed) | Intergenic | ||