ID: 1203071545

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1081075-1081097
Sequence CGAGACCATCCTGGCTAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 371233
Summary {0: 183, 1: 38526, 2: 55305, 3: 96523, 4: 180696}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203071545_1203071549 8 Left 1203071545 16_KI270728v1_random:1081075-1081097 CCATCTTAGCCAGGATGGTCTCG 0: 183
1: 38526
2: 55305
3: 96523
4: 180696
Right 1203071549 16_KI270728v1_random:1081106-1081128 GCCTTGTAATACGCCCGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203071545 Original CRISPR CGAGACCATCCTGGCTAAGA TGG (reversed) Intergenic
Too many off-targets to display for this crispr