ID: 1203071546

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1081084-1081106
Sequence CCAGGAGATCGAGACCATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 513814
Summary {0: 389, 1: 53730, 2: 75466, 3: 152867, 4: 231362}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203071546_1203071549 -1 Left 1203071546 16_KI270728v1_random:1081084-1081106 CCAGGATGGTCTCGATCTCCTGG 0: 389
1: 53730
2: 75466
3: 152867
4: 231362
Right 1203071549 16_KI270728v1_random:1081106-1081128 GCCTTGTAATACGCCCGCCTTGG No data
1203071546_1203071555 24 Left 1203071546 16_KI270728v1_random:1081084-1081106 CCAGGATGGTCTCGATCTCCTGG 0: 389
1: 53730
2: 75466
3: 152867
4: 231362
Right 1203071555 16_KI270728v1_random:1081131-1081153 TCCCAAAGTGCTGAGATTACAGG 0: 16720
1: 305812
2: 257224
3: 144363
4: 132215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203071546 Original CRISPR CCAGGAGATCGAGACCATCC TGG (reversed) Intergenic
Too many off-targets to display for this crispr