ID: 1203071549

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1081106-1081128
Sequence GCCTTGTAATACGCCCGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203071546_1203071549 -1 Left 1203071546 16_KI270728v1_random:1081084-1081106 CCAGGATGGTCTCGATCTCCTGG No data
Right 1203071549 16_KI270728v1_random:1081106-1081128 GCCTTGTAATACGCCCGCCTTGG No data
1203071545_1203071549 8 Left 1203071545 16_KI270728v1_random:1081075-1081097 CCATCTTAGCCAGGATGGTCTCG No data
Right 1203071549 16_KI270728v1_random:1081106-1081128 GCCTTGTAATACGCCCGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203071549 Original CRISPR GCCTTGTAATACGCCCGCCT TGG Intergenic