ID: 1203074427

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1110308-1110330
Sequence CCTGTTCTGCAGAGGTAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203074427_1203074432 9 Left 1203074427 16_KI270728v1_random:1110308-1110330 CCTCCCTACCTCTGCAGAACAGG No data
Right 1203074432 16_KI270728v1_random:1110340-1110362 CTGAGATGCCATTTCCTGCCAGG No data
1203074427_1203074433 10 Left 1203074427 16_KI270728v1_random:1110308-1110330 CCTCCCTACCTCTGCAGAACAGG No data
Right 1203074433 16_KI270728v1_random:1110341-1110363 TGAGATGCCATTTCCTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203074427 Original CRISPR CCTGTTCTGCAGAGGTAGGG AGG (reversed) Intergenic
No off target data available for this crispr