ID: 1203077052

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1127330-1127352
Sequence GCCTCCCAGCACACAGACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203077052_1203077058 18 Left 1203077052 16_KI270728v1_random:1127330-1127352 CCAGTGTCTGTGTGCTGGGAGGC No data
Right 1203077058 16_KI270728v1_random:1127371-1127393 GCTGTACCAAAATGGACTTGGGG No data
1203077052_1203077057 17 Left 1203077052 16_KI270728v1_random:1127330-1127352 CCAGTGTCTGTGTGCTGGGAGGC No data
Right 1203077057 16_KI270728v1_random:1127370-1127392 AGCTGTACCAAAATGGACTTGGG No data
1203077052_1203077056 16 Left 1203077052 16_KI270728v1_random:1127330-1127352 CCAGTGTCTGTGTGCTGGGAGGC No data
Right 1203077056 16_KI270728v1_random:1127369-1127391 CAGCTGTACCAAAATGGACTTGG No data
1203077052_1203077060 29 Left 1203077052 16_KI270728v1_random:1127330-1127352 CCAGTGTCTGTGTGCTGGGAGGC No data
Right 1203077060 16_KI270728v1_random:1127382-1127404 ATGGACTTGGGGCAGCCCTTTGG No data
1203077052_1203077061 30 Left 1203077052 16_KI270728v1_random:1127330-1127352 CCAGTGTCTGTGTGCTGGGAGGC No data
Right 1203077061 16_KI270728v1_random:1127383-1127405 TGGACTTGGGGCAGCCCTTTGGG No data
1203077052_1203077055 10 Left 1203077052 16_KI270728v1_random:1127330-1127352 CCAGTGTCTGTGTGCTGGGAGGC No data
Right 1203077055 16_KI270728v1_random:1127363-1127385 GCAACGCAGCTGTACCAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203077052 Original CRISPR GCCTCCCAGCACACAGACAC TGG (reversed) Intergenic