ID: 1203077061

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1127383-1127405
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 4, 1: 0, 2: 1, 3: 17, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203077052_1203077061 30 Left 1203077052 16_KI270728v1_random:1127330-1127352 CCAGTGTCTGTGTGCTGGGAGGC No data
Right 1203077061 16_KI270728v1_random:1127383-1127405 TGGACTTGGGGCAGCCCTTTGGG 0: 4
1: 0
2: 1
3: 17
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203077061 Original CRISPR TGGACTTGGGGCAGCCCTTT GGG Intergenic
900317774 1:2068038-2068060 TGGACGTGTGGCGGCCCTGTCGG + Intronic
900940945 1:5798290-5798312 TGGACTTGGCGGAGCCCCTCGGG - Intergenic
901286094 1:8080049-8080071 AGGACTTGGGGCAGACTTGTTGG + Intergenic
901727793 1:11255909-11255931 AGGGCTTGTGGCTGCCCTTTAGG + Intronic
902036238 1:13460379-13460401 TGAGCAGGGGGCAGCCCTTTCGG + Intergenic
904625208 1:31798522-31798544 TGGCATTGAGGCAGCCCTCTGGG - Exonic
905757039 1:40519342-40519364 TGGATTTTGCGCAGCCGTTTTGG - Intergenic
905850454 1:41270524-41270546 TGGAGTTGGTGCAGCCATCTTGG + Intergenic
907460403 1:54602161-54602183 TGGGCTTGAGGCAGGCCATTGGG + Intronic
912935958 1:114003703-114003725 TGGACTTGGGGCAGAACCATAGG - Intergenic
921277658 1:213535717-213535739 TGGAGCTGTTGCAGCCCTTTTGG - Intergenic
922738170 1:228000907-228000929 GGGGCTTGGGGCACCTCTTTGGG - Intergenic
1066798066 10:39147638-39147660 TGGACTTGTGGGAGCTCATTGGG + Intergenic
1066929225 10:41735842-41735864 TGGACTTTTTGGAGCCCTTTGGG + Intergenic
1068645264 10:59459074-59459096 TGAAATTGGTGCAGCCCCTTTGG - Intergenic
1072157053 10:92733244-92733266 TGAACTTGAGGAAGCCCTCTTGG + Intergenic
1072909310 10:99485658-99485680 TGGAGTTGGGGAAGCCTTTCAGG - Intergenic
1073353765 10:102837568-102837590 TGGAGTTGAGCCAGCCCTTGAGG - Intergenic
1074976338 10:118584946-118584968 TGGACTTGTGGTAGTCCTGTGGG + Intergenic
1075532947 10:123245534-123245556 TGGAGCTGGAGAAGCCCTTTGGG - Intergenic
1075740069 10:124689872-124689894 GGGTCTTGTGACAGCCCTTTTGG + Intronic
1076688140 10:132207396-132207418 TGGACTTGGGGCAGCCAGTGGGG - Intergenic
1076701105 10:132273246-132273268 TTGACTGGGGGCTGCCCTCTTGG - Intronic
1078358501 11:10650413-10650435 TAGTCTTGGGGCAGCTGTTTGGG + Intronic
1080401997 11:31944934-31944956 AGGAGTTGGAGCAGCCATTTTGG + Intronic
1081796983 11:45827319-45827341 TGGAGCTGTGGCAGCCATTTGGG + Intergenic
1081809433 11:45906795-45906817 TGGACTTGGGGCACCTCTTAGGG + Intronic
1085081381 11:73637186-73637208 TGGAATTGGAGCAGCCATCTTGG - Intergenic
1088687629 11:112298270-112298292 TAGACTTGGGGCTGCGCTGTGGG - Intergenic
1088801321 11:113309957-113309979 TGGAGCTGGGCCAGCCATTTTGG - Intergenic
1089366676 11:117924890-117924912 GGGACTTGGGTCAGCCCTTGAGG + Intronic
1089581057 11:119482244-119482266 GGGGCCTGGGGCAGCCCCTTGGG - Intergenic
1091678869 12:2511973-2511995 TGTCCTGGGGGCTGCCCTTTTGG - Intronic
1096799031 12:54097193-54097215 AGGAGTTGGGTCAGGCCTTTGGG - Intergenic
1097100243 12:56582927-56582949 TGGGCGTGGCGCAGCACTTTGGG - Intronic
1104025505 12:125023303-125023325 TGGAACTGGAGCAGCCATTTTGG - Intronic
1104044885 12:125154660-125154682 TGGGCTAGGGCCAGCCCTTTTGG + Intergenic
1104067474 12:125317496-125317518 TGGGCTGGGGGCAGGACTTTGGG + Intronic
1104805336 12:131586174-131586196 TGGAGCTGGGGCTGCACTTTAGG + Intergenic
1106192251 13:27463857-27463879 TGGACATGGGGGAGCCCTGCAGG - Intergenic
1108319457 13:49274304-49274326 AGGAGTTGGGGCAGTCATTTGGG + Exonic
1112918608 13:104581741-104581763 TGGAGATGGGGCGGCTCTTTGGG + Intergenic
1116748003 14:48846298-48846320 TGGACTCAGGGAAGCCCATTAGG - Intergenic
1120819184 14:88896354-88896376 TGGTCTTGAGCCAGGCCTTTTGG - Intergenic
1121111662 14:91317068-91317090 AGGAAGAGGGGCAGCCCTTTGGG - Intronic
1122137910 14:99645278-99645300 TGGACTTCAGGCCGCCCTTCCGG + Exonic
1122158757 14:99767796-99767818 GGGACTTGGGGGAGGCCTTGAGG - Intronic
1126852866 15:52808344-52808366 TGAATTTGGGGCAGTCATTTAGG - Intergenic
1128312829 15:66642099-66642121 TAGACTTGGGGAAGGCCTTGAGG + Intronic
1128609378 15:69061730-69061752 TAGTATTAGGGCAGCCCTTTTGG - Intronic
1129164729 15:73770091-73770113 TGGACTGGGAGCTGCCCTGTTGG - Intergenic
1132338229 15:101062469-101062491 TGGACTTGGGGATCCCCTATGGG - Intronic
1132379775 15:101358415-101358437 TGAACTTGGGGCACTCCTCTGGG + Intronic
1134809920 16:17158572-17158594 TGGACTTGTGGAAGTCCTTGGGG + Intronic
1135625332 16:23990002-23990024 TGGAGTTGTGGCAGCCCTTTTGG + Intronic
1136663986 16:31792436-31792458 TGGACATGGGTCAGTCCTATTGG - Intronic
1136774634 16:32865247-32865269 TGGACTTGGGGCAGCCCTTTGGG + Intergenic
1136895978 16:33996267-33996289 TGGACTTGGGGCAGCCCTTTGGG - Intergenic
1137604752 16:49780008-49780030 TGGACTTGGGGCTTCCCTGATGG - Intronic
1139706443 16:68744167-68744189 TGGACTTGGTCCAGCCCTTAAGG + Intronic
1140486470 16:75297576-75297598 TGGCCTGTGCGCAGCCCTTTTGG + Intronic
1141984363 16:87570492-87570514 TGGCCTTGGAACAGCCCATTGGG - Intergenic
1142248822 16:88981854-88981876 TGGCCCTGGGGCAGCTCTATCGG + Intergenic
1203077061 16_KI270728v1_random:1127383-1127405 TGGACTTGGGGCAGCCCTTTGGG + Intergenic
1144519328 17:15944019-15944041 GGGACTCGGGGCAGGACTTTGGG + Intergenic
1145058507 17:19718116-19718138 AGGATTTGCGGCTGCCCTTTTGG - Intronic
1146788159 17:35735749-35735771 GGGAGCTGGGGCAGCCCTTAAGG + Intronic
1147135472 17:38431642-38431664 TGGCCTTGGGGCTGGACTTTGGG + Intronic
1151318300 17:73337333-73337355 GGGACTTGGGCCACCCCTCTGGG + Exonic
1152245919 17:79184503-79184525 TGGACTCGGGGCAGGCCAGTGGG - Intronic
1153752346 18:8245621-8245643 TGGAATTGGAGAAGCCCTTTTGG + Intronic
1156191766 18:34728653-34728675 AGAACTTGGGGATGCCCTTTGGG - Intronic
1156263912 18:35468997-35469019 TGGACCTGTTGCAGCCCTTGAGG - Intronic
1156409805 18:36816923-36816945 TGGGCTTAGGTCAGCCCTTTAGG - Intronic
1156479733 18:37428543-37428565 TGGAGTAGGTGCAGCCCCTTTGG - Intronic
1156600862 18:38604442-38604464 GGGACTTGATGCAGCCCATTAGG - Intergenic
1158403435 18:57140966-57140988 TGCAGTTGGGGAGGCCCTTTGGG + Intergenic
1158416549 18:57253939-57253961 TGGCCCTGGGGCTGTCCTTTAGG + Intergenic
1160907149 19:1456741-1456763 TGGGCGTGGGGCTGCCCTTGGGG + Intronic
1161429683 19:4224368-4224390 GGGACTTGGGGCAGCCATGGAGG + Intronic
1162132133 19:8532983-8533005 TGGACTTGGGAAAGCACTCTGGG - Intronic
1162242100 19:9363249-9363271 TGGGCTTGGGGCTGCCATTCCGG + Intronic
1162462568 19:10821857-10821879 TGGAGTCTGGGCAGCCATTTTGG - Intronic
1163988368 19:20973658-20973680 TGGACCTGCTACAGCCCTTTTGG - Intergenic
1164306306 19:24006696-24006718 TGGACTTGGTAAAGCCCTTGAGG - Intergenic
1164722276 19:30441224-30441246 TGGAAGTGGGCCAGCCCTGTTGG + Intronic
1164864836 19:31596226-31596248 TGGATCTGGGGCAGCCTTTGGGG + Intergenic
1167304657 19:48700665-48700687 TGGATGTGTAGCAGCCCTTTTGG - Intronic
1167305266 19:48704619-48704641 TGGATGTGTAGCAGCCCTTTTGG - Exonic
1167502370 19:49855339-49855361 GGGACTGGGGCCAGCCCTGTTGG + Intronic
1168147648 19:54428975-54428997 TGGACTTGGGGGAGCCTTCGGGG + Intronic
928081833 2:28318914-28318936 TGGAGTTTGGGCAGCCCTACAGG - Intronic
928084546 2:28337555-28337577 AGGACCGGGGGCAGCCCGTTTGG - Intronic
928941338 2:36730462-36730484 TGGAGCTGGGGCAGCCATTTTGG - Intronic
929597339 2:43184454-43184476 TGAACTTGTAGCAGCCCATTCGG - Intergenic
930708479 2:54527680-54527702 GGGACCTGGGGCAGCCATCTTGG - Intronic
930763746 2:55062953-55062975 TGGAACTGGGGCAACCATTTTGG + Intronic
931066950 2:58598097-58598119 TGGACTTGGGGCATTTCATTTGG + Intergenic
936377527 2:111954744-111954766 TGGACTTGTTTTAGCCCTTTGGG - Intronic
936401410 2:112167355-112167377 TGGACTGTGGGGAGCGCTTTGGG - Intronic
937906425 2:127054988-127055010 TGTACCTGGGGCTTCCCTTTGGG + Intronic
947581260 2:231320327-231320349 TGCAAATGGGTCAGCCCTTTGGG - Intronic
948851833 2:240712044-240712066 TGCACTGGGGGCGGTCCTTTAGG - Intergenic
948995082 2:241573928-241573950 TGGACATGGGGCAGTCGTTCTGG + Exonic
1170871585 20:20211242-20211264 GCCACGTGGGGCAGCCCTTTGGG - Intronic
1171385439 20:24766643-24766665 TGGAGCTGGAGCAGCCATTTTGG - Intergenic
1171797391 20:29577156-29577178 AGGAGTTGGGTCAGGCCTTTGGG + Intergenic
1171850860 20:30307005-30307027 AGGAGTTGGGTCAGGCCTTTGGG - Intergenic
1173844643 20:46180210-46180232 TGGTCTTGGGTCAGCCCCTCAGG + Intronic
1174511952 20:51060124-51060146 TGGAAATGGGGCCTCCCTTTTGG + Intergenic
1175571110 20:60023113-60023135 TGGAGGTGGGGCAGCCATTCTGG + Intronic
1175670344 20:60897182-60897204 TGGAGTGGGGGCGGCCCTGTAGG + Intergenic
1177984291 21:27954283-27954305 TGGGCTAGGTGCAGCGCTTTGGG + Intergenic
1179130305 21:38630408-38630430 TGGAGTTGGAGCAGCCATGTTGG - Intronic
1179805598 21:43835233-43835255 TGGTGTTTGGGGAGCCCTTTGGG + Intergenic
1180998187 22:19975849-19975871 TGGACATGGGGGTGCCTTTTGGG - Intronic
1181168426 22:20995270-20995292 TGGACATGGGGCACCTCTTTCGG + Intronic
1181290472 22:21788793-21788815 TGGACTTGGTGTAGCCCTGCAGG + Exonic
1181766756 22:25097938-25097960 TGGAACTGTGGCAGCCATTTGGG - Intronic
1183684038 22:39351230-39351252 TGGCCTTGGGGTAGCCCCTGGGG - Intronic
1184020114 22:41815139-41815161 TGGGCTTGGGGCAGACTGTTGGG - Intronic
1184255738 22:43285795-43285817 TGGCCTCGGGGCAGCCCTCCAGG - Intronic
1184301225 22:43562471-43562493 TGGCGTTGGGGCAGCCTGTTGGG - Intronic
951170180 3:19532885-19532907 TGGAGTTGGAGCAGCCTTTCAGG + Intronic
956269476 3:67434852-67434874 TGGACTTGACCCAGCCCTTTTGG - Intronic
956705808 3:71998120-71998142 TGGAGCTGGAGCAGCCATTTGGG - Intergenic
956869986 3:73407268-73407290 TGGACTTGTGGCAGCATCTTGGG + Intronic
957607461 3:82420721-82420743 TCAATTTGGGGCAGCCCTTCTGG + Intergenic
961139879 3:124546886-124546908 TGGGCTTGGGGCAGGTATTTGGG + Intronic
962009337 3:131379324-131379346 TGAACTTGGAACAGCTCTTTAGG + Intergenic
962335070 3:134521969-134521991 TGGACTTGGGGGAGCTGTTCTGG + Intronic
964606614 3:158566823-158566845 TGGACTAGAGGCAGCCCTACTGG + Intergenic
966388576 3:179427972-179427994 TGGACTTAGGACAGTCATTTCGG - Intronic
968578165 4:1377520-1377542 TGGCCTTGGGGCACCCCTGGTGG - Intronic
968915693 4:3496207-3496229 GGGACTTGGGGCACCCCGTTAGG + Intronic
971362715 4:25952099-25952121 TGGACTTGGGGCTGAGCCTTTGG + Intergenic
972307686 4:37847737-37847759 TGGACCTGGGTCATCCTTTTGGG - Intronic
972571005 4:40310418-40310440 TGGAGCTGGAGCAGCCATTTTGG - Intergenic
973948633 4:55987445-55987467 TGAACTTGGGGCAGACCACTGGG + Intronic
979305201 4:119134592-119134614 TGGAGCTGGGGCAGCCAATTAGG + Intergenic
987792259 5:22582882-22582904 TGGACTTTGGCCAGCACTATAGG + Intronic
988584086 5:32493832-32493854 TGGACTATGGGCAGTCATTTTGG + Intergenic
990289657 5:54335540-54335562 TTGCCTTGGGGAAGACCTTTTGG - Intergenic
990609009 5:57439190-57439212 TGGAGTTGCTGCAGCCATTTTGG + Intergenic
991624342 5:68584331-68584353 TGTAATTGGTGCAGCTCTTTAGG + Intergenic
993054139 5:82961670-82961692 TGGACATGGGGCAGCCTTCTGGG + Intergenic
994490030 5:100429855-100429877 TGTACTTGGAGCAGCTCTATGGG - Intergenic
997444816 5:133933370-133933392 TGGGCCTGGGGCAGCCCCATGGG - Intergenic
999529610 5:152448236-152448258 TTGACTTAGGTCAGCCCTCTGGG + Intergenic
1001080857 5:168666389-168666411 TGGAGTTGGGACAGCCATGTGGG - Exonic
1002198078 5:177511980-177512002 TGGACTTCGGGCCCCCCGTTAGG + Intronic
1002372489 5:178766623-178766645 TGGGCTAGGGCCAGCCCTTTTGG - Intergenic
1006301698 6:33196747-33196769 TGGACTGGGGGCAGCCCTGAAGG + Intronic
1010070359 6:71737174-71737196 TGGGGATGGGGCAGCACTTTGGG - Intergenic
1011675637 6:89730888-89730910 TGGGTTTGGTACAGCCCTTTTGG - Exonic
1015286476 6:131491061-131491083 TGAAGTTGGGGCAGCCTTGTAGG + Intergenic
1015310630 6:131763178-131763200 AGGACTTGGTGTAGCCCTTGCGG + Intergenic
1015818719 6:137237469-137237491 TGGAGTTCAGGCAGACCTTTGGG + Intergenic
1017567020 6:155698342-155698364 AGGACTTGCGCCAGCCCTCTGGG + Intergenic
1019435311 7:1019587-1019609 TGGCCGTGGGGCTGCCCTGTGGG + Intronic
1020544943 7:9515955-9515977 TGGACTTGTGGCAGGACTTCTGG + Intergenic
1021944882 7:25716817-25716839 TGGACTTGGTGCAGTCCATTGGG - Intergenic
1022443062 7:30449531-30449553 TGGAGTTTGAGCAGCCCTCTTGG + Intronic
1025103780 7:56154356-56154378 TGGACTCAGGGCATTCCTTTGGG - Intergenic
1025527011 7:61827030-61827052 TGGACTTTTGGGAGCTCTTTGGG - Intergenic
1026498817 7:70925616-70925638 TGGAATGTGGGCAGCCCATTGGG + Intergenic
1026770430 7:73194064-73194086 TGAACTTGGCTCTGCCCTTTAGG - Intergenic
1027011296 7:74747450-74747472 TGAACTTGGCTCTGCCCTTTAGG - Intronic
1027076744 7:75198596-75198618 TGAACTTGGCTCTGCCCTTTAGG + Intergenic
1028093641 7:86733492-86733514 TGGAGTTGGCCCATCCCTTTTGG - Intronic
1029049575 7:97670431-97670453 TGGAGTTGGGGCATGACTTTAGG - Intergenic
1029465304 7:100721156-100721178 GGGACTTGGGGGAGTCCTTGGGG + Intronic
1030215530 7:107041410-107041432 TGGCCCTGGAGCAGCCATTTTGG + Intergenic
1032540868 7:132702031-132702053 TGGAGCTGGGGCAGCCATTTTGG - Intronic
1035720233 8:1785875-1785897 TGGTGTTGGGGCAGCCCTCAGGG + Exonic
1036372342 8:8172296-8172318 GGCAGTTGAGGCAGCCCTTTAGG + Intergenic
1036556152 8:9862175-9862197 TGGACGTGGGACAGCCCTGAAGG - Intergenic
1036687305 8:10920523-10920545 TGGACTTGGAACAGACCTGTTGG - Intronic
1036878560 8:12493345-12493367 GGCAGTTGAGGCAGCCCTTTAGG - Intergenic
1037550133 8:19962712-19962734 GGTGCTTGGGGCAGCCCTGTTGG - Intronic
1037638338 8:20720408-20720430 GGGGCTTGGGGCAGCCCATGAGG - Intergenic
1037668633 8:20995831-20995853 TGTAGTTGGGGAAGACCTTTTGG + Intergenic
1038405629 8:27320403-27320425 GGGAGTTGGGGCAGTCCTGTGGG - Intronic
1039761666 8:40583405-40583427 TCAACTTCAGGCAGCCCTTTTGG - Intronic
1041415827 8:57607907-57607929 AGGACTTGGTGTAGCCCTTTTGG + Intergenic
1042632628 8:70836328-70836350 AGGACATGGGGGAACCCTTTAGG - Intergenic
1045223222 8:100218784-100218806 TGCACTTGTGGGAGCCCTTCTGG - Intronic
1045480494 8:102587740-102587762 TGGAGCTGGGCCAGGCCTTTGGG + Intergenic
1048590715 8:135818388-135818410 TGGCCTTGGGGAACCCCATTAGG + Intergenic
1049269714 8:141688028-141688050 TGGAGCTGAAGCAGCCCTTTTGG + Intergenic
1051049609 9:12915523-12915545 TAGACATGGGGAAGCCATTTAGG - Intergenic
1051991421 9:23156869-23156891 TGGACATGCTGCAGCCCTATGGG - Intergenic
1053788639 9:41670297-41670319 AGGAGTTGGGTCAGGCCTTTGGG - Intergenic
1054156499 9:61644471-61644493 AGGAGTTGGGTCAGGCCTTTGGG + Intergenic
1054176924 9:61881636-61881658 AGGAGTTGGGTCAGGCCTTTGGG - Intergenic
1054476270 9:65575480-65575502 AGGAGTTGGGTCAGGCCTTTGGG + Intergenic
1054660611 9:67699170-67699192 AGGAGTTGGGTCAGGCCTTTGGG + Intergenic
1055954189 9:81758668-81758690 GGGACATGGAGCAGGCCTTTTGG + Intergenic
1058892531 9:109373253-109373275 TGGAGCTGGAGCAGCCATTTTGG + Intergenic
1061442644 9:130616752-130616774 TGAACTTTGAGCAGCCTTTTTGG + Intronic
1186189847 X:7057572-7057594 GGGTCTTGGGGCCGCCATTTTGG + Intronic
1189330398 X:40141247-40141269 TGAACTTGAGCCAGCCCTGTTGG + Intronic
1194378415 X:93164311-93164333 AGCAATTGGAGCAGCCCTTTTGG + Intergenic
1196021757 X:110998137-110998159 TGGACTCGGGTCAGAACTTTGGG + Intronic
1198262942 X:134982751-134982773 GGGACTTTGGGCATCCTTTTTGG - Intergenic
1200105308 X:153708808-153708830 TGGACTTGGGGCAGCCCTTTGGG - Intronic