ID: 1203077061

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1127383-1127405
Sequence TGGACTTGGGGCAGCCCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203077052_1203077061 30 Left 1203077052 16_KI270728v1_random:1127330-1127352 CCAGTGTCTGTGTGCTGGGAGGC No data
Right 1203077061 16_KI270728v1_random:1127383-1127405 TGGACTTGGGGCAGCCCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203077061 Original CRISPR TGGACTTGGGGCAGCCCTTT GGG Intergenic