ID: 1203077455

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1129481-1129503
Sequence AGACTCAGCTTGTCCAAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203077455_1203077465 26 Left 1203077455 16_KI270728v1_random:1129481-1129503 CCCATTTTGGACAAGCTGAGTCT No data
Right 1203077465 16_KI270728v1_random:1129530-1129552 CCAATGTTTAGCAGGAGGTTAGG 0: 4
1: 0
2: 0
3: 7
4: 113
1203077455_1203077457 -10 Left 1203077455 16_KI270728v1_random:1129481-1129503 CCCATTTTGGACAAGCTGAGTCT No data
Right 1203077457 16_KI270728v1_random:1129494-1129516 AGCTGAGTCTAGAATGTCTCTGG 0: 4
1: 0
2: 0
3: 13
4: 194
1203077455_1203077461 18 Left 1203077455 16_KI270728v1_random:1129481-1129503 CCCATTTTGGACAAGCTGAGTCT No data
Right 1203077461 16_KI270728v1_random:1129522-1129544 TCCAGGAGCCAATGTTTAGCAGG 0: 4
1: 0
2: 0
3: 11
4: 116
1203077455_1203077458 -9 Left 1203077455 16_KI270728v1_random:1129481-1129503 CCCATTTTGGACAAGCTGAGTCT No data
Right 1203077458 16_KI270728v1_random:1129495-1129517 GCTGAGTCTAGAATGTCTCTGGG 0: 4
1: 0
2: 0
3: 11
4: 156
1203077455_1203077463 21 Left 1203077455 16_KI270728v1_random:1129481-1129503 CCCATTTTGGACAAGCTGAGTCT No data
Right 1203077463 16_KI270728v1_random:1129525-1129547 AGGAGCCAATGTTTAGCAGGAGG 0: 4
1: 0
2: 1
3: 5
4: 118
1203077455_1203077460 1 Left 1203077455 16_KI270728v1_random:1129481-1129503 CCCATTTTGGACAAGCTGAGTCT No data
Right 1203077460 16_KI270728v1_random:1129505-1129527 GAATGTCTCTGGGGACATCCAGG 0: 4
1: 0
2: 1
3: 20
4: 140
1203077455_1203077459 -8 Left 1203077455 16_KI270728v1_random:1129481-1129503 CCCATTTTGGACAAGCTGAGTCT No data
Right 1203077459 16_KI270728v1_random:1129496-1129518 CTGAGTCTAGAATGTCTCTGGGG 0: 4
1: 0
2: 0
3: 13
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203077455 Original CRISPR AGACTCAGCTTGTCCAAAAT GGG (reversed) Intergenic
No off target data available for this crispr