ID: 1203078589

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1135107-1135129
Sequence CCTGCCCCAGAGGTCCAGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203078589_1203078604 28 Left 1203078589 16_KI270728v1_random:1135107-1135129 CCGAGCTGGACCTCTGGGGCAGG No data
Right 1203078604 16_KI270728v1_random:1135158-1135180 CCTGGCCAACCTACTGCTGTGGG No data
1203078589_1203078600 4 Left 1203078589 16_KI270728v1_random:1135107-1135129 CCGAGCTGGACCTCTGGGGCAGG No data
Right 1203078600 16_KI270728v1_random:1135134-1135156 TGGAGATGGCAGGGGAAGAGTGG No data
1203078589_1203078602 27 Left 1203078589 16_KI270728v1_random:1135107-1135129 CCGAGCTGGACCTCTGGGGCAGG No data
Right 1203078602 16_KI270728v1_random:1135157-1135179 ACCTGGCCAACCTACTGCTGTGG No data
1203078589_1203078601 10 Left 1203078589 16_KI270728v1_random:1135107-1135129 CCGAGCTGGACCTCTGGGGCAGG No data
Right 1203078601 16_KI270728v1_random:1135140-1135162 TGGCAGGGGAAGAGTGGACCTGG No data
1203078589_1203078598 -5 Left 1203078589 16_KI270728v1_random:1135107-1135129 CCGAGCTGGACCTCTGGGGCAGG No data
Right 1203078598 16_KI270728v1_random:1135125-1135147 GCAGGGGGCTGGAGATGGCAGGG No data
1203078589_1203078597 -6 Left 1203078589 16_KI270728v1_random:1135107-1135129 CCGAGCTGGACCTCTGGGGCAGG No data
Right 1203078597 16_KI270728v1_random:1135124-1135146 GGCAGGGGGCTGGAGATGGCAGG No data
1203078589_1203078599 -4 Left 1203078589 16_KI270728v1_random:1135107-1135129 CCGAGCTGGACCTCTGGGGCAGG No data
Right 1203078599 16_KI270728v1_random:1135126-1135148 CAGGGGGCTGGAGATGGCAGGGG No data
1203078589_1203078596 -10 Left 1203078589 16_KI270728v1_random:1135107-1135129 CCGAGCTGGACCTCTGGGGCAGG No data
Right 1203078596 16_KI270728v1_random:1135120-1135142 CTGGGGCAGGGGGCTGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203078589 Original CRISPR CCTGCCCCAGAGGTCCAGCT CGG (reversed) Intergenic
No off target data available for this crispr