ID: 1203078595

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1135117-1135139
Sequence TCTCCAGCCCCCTGCCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203078595_1203078600 -6 Left 1203078595 16_KI270728v1_random:1135117-1135139 CCTCTGGGGCAGGGGGCTGGAGA No data
Right 1203078600 16_KI270728v1_random:1135134-1135156 TGGAGATGGCAGGGGAAGAGTGG No data
1203078595_1203078601 0 Left 1203078595 16_KI270728v1_random:1135117-1135139 CCTCTGGGGCAGGGGGCTGGAGA No data
Right 1203078601 16_KI270728v1_random:1135140-1135162 TGGCAGGGGAAGAGTGGACCTGG No data
1203078595_1203078602 17 Left 1203078595 16_KI270728v1_random:1135117-1135139 CCTCTGGGGCAGGGGGCTGGAGA No data
Right 1203078602 16_KI270728v1_random:1135157-1135179 ACCTGGCCAACCTACTGCTGTGG No data
1203078595_1203078604 18 Left 1203078595 16_KI270728v1_random:1135117-1135139 CCTCTGGGGCAGGGGGCTGGAGA No data
Right 1203078604 16_KI270728v1_random:1135158-1135180 CCTGGCCAACCTACTGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203078595 Original CRISPR TCTCCAGCCCCCTGCCCCAG AGG (reversed) Intergenic
No off target data available for this crispr