ID: 1203078601

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1135140-1135162
Sequence TGGCAGGGGAAGAGTGGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203078589_1203078601 10 Left 1203078589 16_KI270728v1_random:1135107-1135129 CCGAGCTGGACCTCTGGGGCAGG No data
Right 1203078601 16_KI270728v1_random:1135140-1135162 TGGCAGGGGAAGAGTGGACCTGG No data
1203078595_1203078601 0 Left 1203078595 16_KI270728v1_random:1135117-1135139 CCTCTGGGGCAGGGGGCTGGAGA No data
Right 1203078601 16_KI270728v1_random:1135140-1135162 TGGCAGGGGAAGAGTGGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203078601 Original CRISPR TGGCAGGGGAAGAGTGGACC TGG Intergenic
No off target data available for this crispr