ID: 1203078606

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1135167-1135189
Sequence GACAGAAATCCCACAGCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203078606_1203078615 27 Left 1203078606 16_KI270728v1_random:1135167-1135189 CCTACTGCTGTGGGATTTCTGTC No data
Right 1203078615 16_KI270728v1_random:1135217-1135239 ATGGACAAGAAGAAAGAGTAAGG No data
1203078606_1203078610 0 Left 1203078606 16_KI270728v1_random:1135167-1135189 CCTACTGCTGTGGGATTTCTGTC No data
Right 1203078610 16_KI270728v1_random:1135190-1135212 CCTTTCCAGGCTACAGTAGTTGG No data
1203078606_1203078616 28 Left 1203078606 16_KI270728v1_random:1135167-1135189 CCTACTGCTGTGGGATTTCTGTC No data
Right 1203078616 16_KI270728v1_random:1135218-1135240 TGGACAAGAAGAAAGAGTAAGGG No data
1203078606_1203078612 8 Left 1203078606 16_KI270728v1_random:1135167-1135189 CCTACTGCTGTGGGATTTCTGTC No data
Right 1203078612 16_KI270728v1_random:1135198-1135220 GGCTACAGTAGTTGGTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203078606 Original CRISPR GACAGAAATCCCACAGCAGT AGG (reversed) Intergenic
No off target data available for this crispr