ID: 1203078608 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16_KI270728v1_random:1135189-1135211 |
| Sequence | CAACTACTGTAGCCTGGAAA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1203078608_1203078617 | 22 | Left | 1203078608 | 16_KI270728v1_random:1135189-1135211 | CCCTTTCCAGGCTACAGTAGTTG | No data | ||
| Right | 1203078617 | 16_KI270728v1_random:1135234-1135256 | GTAAGGGCCTCCTTCCTCCCTGG | No data | ||||
| 1203078608_1203078616 | 6 | Left | 1203078608 | 16_KI270728v1_random:1135189-1135211 | CCCTTTCCAGGCTACAGTAGTTG | No data | ||
| Right | 1203078616 | 16_KI270728v1_random:1135218-1135240 | TGGACAAGAAGAAAGAGTAAGGG | No data | ||||
| 1203078608_1203078615 | 5 | Left | 1203078608 | 16_KI270728v1_random:1135189-1135211 | CCCTTTCCAGGCTACAGTAGTTG | No data | ||
| Right | 1203078615 | 16_KI270728v1_random:1135217-1135239 | ATGGACAAGAAGAAAGAGTAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1203078608 | Original CRISPR | CAACTACTGTAGCCTGGAAA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||