ID: 1203078609

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1135190-1135212
Sequence CCAACTACTGTAGCCTGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203078609_1203078617 21 Left 1203078609 16_KI270728v1_random:1135190-1135212 CCTTTCCAGGCTACAGTAGTTGG No data
Right 1203078617 16_KI270728v1_random:1135234-1135256 GTAAGGGCCTCCTTCCTCCCTGG No data
1203078609_1203078616 5 Left 1203078609 16_KI270728v1_random:1135190-1135212 CCTTTCCAGGCTACAGTAGTTGG No data
Right 1203078616 16_KI270728v1_random:1135218-1135240 TGGACAAGAAGAAAGAGTAAGGG No data
1203078609_1203078615 4 Left 1203078609 16_KI270728v1_random:1135190-1135212 CCTTTCCAGGCTACAGTAGTTGG No data
Right 1203078615 16_KI270728v1_random:1135217-1135239 ATGGACAAGAAGAAAGAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203078609 Original CRISPR CCAACTACTGTAGCCTGGAA AGG (reversed) Intergenic
No off target data available for this crispr