ID: 1203078611

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1135195-1135217
Sequence TGGGACCAACTACTGTAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203078611_1203078616 0 Left 1203078611 16_KI270728v1_random:1135195-1135217 CCAGGCTACAGTAGTTGGTCCCA No data
Right 1203078616 16_KI270728v1_random:1135218-1135240 TGGACAAGAAGAAAGAGTAAGGG No data
1203078611_1203078615 -1 Left 1203078611 16_KI270728v1_random:1135195-1135217 CCAGGCTACAGTAGTTGGTCCCA No data
Right 1203078615 16_KI270728v1_random:1135217-1135239 ATGGACAAGAAGAAAGAGTAAGG No data
1203078611_1203078617 16 Left 1203078611 16_KI270728v1_random:1135195-1135217 CCAGGCTACAGTAGTTGGTCCCA No data
Right 1203078617 16_KI270728v1_random:1135234-1135256 GTAAGGGCCTCCTTCCTCCCTGG No data
1203078611_1203078620 27 Left 1203078611 16_KI270728v1_random:1135195-1135217 CCAGGCTACAGTAGTTGGTCCCA No data
Right 1203078620 16_KI270728v1_random:1135245-1135267 CTTCCTCCCTGGCCTGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203078611 Original CRISPR TGGGACCAACTACTGTAGCC TGG (reversed) Intergenic
No off target data available for this crispr