ID: 1203078615

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1135217-1135239
Sequence ATGGACAAGAAGAAAGAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203078611_1203078615 -1 Left 1203078611 16_KI270728v1_random:1135195-1135217 CCAGGCTACAGTAGTTGGTCCCA No data
Right 1203078615 16_KI270728v1_random:1135217-1135239 ATGGACAAGAAGAAAGAGTAAGG No data
1203078608_1203078615 5 Left 1203078608 16_KI270728v1_random:1135189-1135211 CCCTTTCCAGGCTACAGTAGTTG No data
Right 1203078615 16_KI270728v1_random:1135217-1135239 ATGGACAAGAAGAAAGAGTAAGG No data
1203078609_1203078615 4 Left 1203078609 16_KI270728v1_random:1135190-1135212 CCTTTCCAGGCTACAGTAGTTGG No data
Right 1203078615 16_KI270728v1_random:1135217-1135239 ATGGACAAGAAGAAAGAGTAAGG No data
1203078606_1203078615 27 Left 1203078606 16_KI270728v1_random:1135167-1135189 CCTACTGCTGTGGGATTTCTGTC No data
Right 1203078615 16_KI270728v1_random:1135217-1135239 ATGGACAAGAAGAAAGAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203078615 Original CRISPR ATGGACAAGAAGAAAGAGTA AGG Intergenic
No off target data available for this crispr