ID: 1203079453

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1139645-1139667
Sequence CGTGAGGGTGGTGGGCCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203079453_1203079474 29 Left 1203079453 16_KI270728v1_random:1139645-1139667 CCCGCAGGCCCACCACCCTCACG No data
Right 1203079474 16_KI270728v1_random:1139697-1139719 TGTCAGGGAAGCCTTTCTTGGGG No data
1203079453_1203079473 28 Left 1203079453 16_KI270728v1_random:1139645-1139667 CCCGCAGGCCCACCACCCTCACG No data
Right 1203079473 16_KI270728v1_random:1139696-1139718 GTGTCAGGGAAGCCTTTCTTGGG No data
1203079453_1203079464 6 Left 1203079453 16_KI270728v1_random:1139645-1139667 CCCGCAGGCCCACCACCCTCACG No data
Right 1203079464 16_KI270728v1_random:1139674-1139696 CAGCCCTCCAGCCTCTGTCCGGG No data
1203079453_1203079469 14 Left 1203079453 16_KI270728v1_random:1139645-1139667 CCCGCAGGCCCACCACCCTCACG No data
Right 1203079469 16_KI270728v1_random:1139682-1139704 CAGCCTCTGTCCGGGTGTCAGGG No data
1203079453_1203079463 5 Left 1203079453 16_KI270728v1_random:1139645-1139667 CCCGCAGGCCCACCACCCTCACG No data
Right 1203079463 16_KI270728v1_random:1139673-1139695 CCAGCCCTCCAGCCTCTGTCCGG No data
1203079453_1203079468 13 Left 1203079453 16_KI270728v1_random:1139645-1139667 CCCGCAGGCCCACCACCCTCACG No data
Right 1203079468 16_KI270728v1_random:1139681-1139703 CCAGCCTCTGTCCGGGTGTCAGG No data
1203079453_1203079472 27 Left 1203079453 16_KI270728v1_random:1139645-1139667 CCCGCAGGCCCACCACCCTCACG No data
Right 1203079472 16_KI270728v1_random:1139695-1139717 GGTGTCAGGGAAGCCTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203079453 Original CRISPR CGTGAGGGTGGTGGGCCTGC GGG (reversed) Intergenic
No off target data available for this crispr