ID: 1203081081

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1146579-1146601
Sequence CAAAGTTAGGAGAAGGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203081081_1203081087 -3 Left 1203081081 16_KI270728v1_random:1146579-1146601 CCAGCATCCTTCTCCTAACTTTG No data
Right 1203081087 16_KI270728v1_random:1146599-1146621 TTGGGCAAAGGCCTTTGCTCTGG 0: 4
1: 0
2: 2
3: 15
4: 190
1203081081_1203081090 22 Left 1203081081 16_KI270728v1_random:1146579-1146601 CCAGCATCCTTCTCCTAACTTTG No data
Right 1203081090 16_KI270728v1_random:1146624-1146646 CTCTGTTTCCCACCCATCACTGG 0: 4
1: 0
2: 1
3: 24
4: 240
1203081081_1203081091 23 Left 1203081081 16_KI270728v1_random:1146579-1146601 CCAGCATCCTTCTCCTAACTTTG No data
Right 1203081091 16_KI270728v1_random:1146625-1146647 TCTGTTTCCCACCCATCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203081081 Original CRISPR CAAAGTTAGGAGAAGGATGC TGG (reversed) Intergenic
No off target data available for this crispr