ID: 1203081520

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1148049-1148071
Sequence GTGAGCCGGGCAGCCGCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203081520_1203081525 -5 Left 1203081520 16_KI270728v1_random:1148049-1148071 CCCGCGGCGGCTGCCCGGCTCAC No data
Right 1203081525 16_KI270728v1_random:1148067-1148089 CTCACCCGAGACTCCGTTGGCGG No data
1203081520_1203081526 -2 Left 1203081520 16_KI270728v1_random:1148049-1148071 CCCGCGGCGGCTGCCCGGCTCAC No data
Right 1203081526 16_KI270728v1_random:1148070-1148092 ACCCGAGACTCCGTTGGCGGCGG No data
1203081520_1203081531 10 Left 1203081520 16_KI270728v1_random:1148049-1148071 CCCGCGGCGGCTGCCCGGCTCAC No data
Right 1203081531 16_KI270728v1_random:1148082-1148104 GTTGGCGGCGGCGGCAGCTCAGG No data
1203081520_1203081524 -8 Left 1203081520 16_KI270728v1_random:1148049-1148071 CCCGCGGCGGCTGCCCGGCTCAC No data
Right 1203081524 16_KI270728v1_random:1148064-1148086 CGGCTCACCCGAGACTCCGTTGG No data
1203081520_1203081529 1 Left 1203081520 16_KI270728v1_random:1148049-1148071 CCCGCGGCGGCTGCCCGGCTCAC No data
Right 1203081529 16_KI270728v1_random:1148073-1148095 CGAGACTCCGTTGGCGGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203081520 Original CRISPR GTGAGCCGGGCAGCCGCCGC GGG (reversed) Intergenic
No off target data available for this crispr