ID: 1203081524

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1148064-1148086
Sequence CGGCTCACCCGAGACTCCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203081510_1203081524 10 Left 1203081510 16_KI270728v1_random:1148031-1148053 CCCCGGCCCCGGCCGGGGCCCGC No data
Right 1203081524 16_KI270728v1_random:1148064-1148086 CGGCTCACCCGAGACTCCGTTGG No data
1203081509_1203081524 11 Left 1203081509 16_KI270728v1_random:1148030-1148052 CCCCCGGCCCCGGCCGGGGCCCG No data
Right 1203081524 16_KI270728v1_random:1148064-1148086 CGGCTCACCCGAGACTCCGTTGG No data
1203081515_1203081524 4 Left 1203081515 16_KI270728v1_random:1148037-1148059 CCCCGGCCGGGGCCCGCGGCGGC No data
Right 1203081524 16_KI270728v1_random:1148064-1148086 CGGCTCACCCGAGACTCCGTTGG No data
1203081504_1203081524 17 Left 1203081504 16_KI270728v1_random:1148024-1148046 CCCGCGCCCCCGGCCCCGGCCGG No data
Right 1203081524 16_KI270728v1_random:1148064-1148086 CGGCTCACCCGAGACTCCGTTGG No data
1203081511_1203081524 9 Left 1203081511 16_KI270728v1_random:1148032-1148054 CCCGGCCCCGGCCGGGGCCCGCG No data
Right 1203081524 16_KI270728v1_random:1148064-1148086 CGGCTCACCCGAGACTCCGTTGG No data
1203081512_1203081524 8 Left 1203081512 16_KI270728v1_random:1148033-1148055 CCGGCCCCGGCCGGGGCCCGCGG No data
Right 1203081524 16_KI270728v1_random:1148064-1148086 CGGCTCACCCGAGACTCCGTTGG No data
1203081517_1203081524 2 Left 1203081517 16_KI270728v1_random:1148039-1148061 CCGGCCGGGGCCCGCGGCGGCTG No data
Right 1203081524 16_KI270728v1_random:1148064-1148086 CGGCTCACCCGAGACTCCGTTGG No data
1203081516_1203081524 3 Left 1203081516 16_KI270728v1_random:1148038-1148060 CCCGGCCGGGGCCCGCGGCGGCT No data
Right 1203081524 16_KI270728v1_random:1148064-1148086 CGGCTCACCCGAGACTCCGTTGG No data
1203081520_1203081524 -8 Left 1203081520 16_KI270728v1_random:1148049-1148071 CCCGCGGCGGCTGCCCGGCTCAC No data
Right 1203081524 16_KI270728v1_random:1148064-1148086 CGGCTCACCCGAGACTCCGTTGG No data
1203081502_1203081524 24 Left 1203081502 16_KI270728v1_random:1148017-1148039 CCTGTGGCCCGCGCCCCCGGCCC No data
Right 1203081524 16_KI270728v1_random:1148064-1148086 CGGCTCACCCGAGACTCCGTTGG No data
1203081506_1203081524 16 Left 1203081506 16_KI270728v1_random:1148025-1148047 CCGCGCCCCCGGCCCCGGCCGGG No data
Right 1203081524 16_KI270728v1_random:1148064-1148086 CGGCTCACCCGAGACTCCGTTGG No data
1203081518_1203081524 -2 Left 1203081518 16_KI270728v1_random:1148043-1148065 CCGGGGCCCGCGGCGGCTGCCCG No data
Right 1203081524 16_KI270728v1_random:1148064-1148086 CGGCTCACCCGAGACTCCGTTGG No data
1203081521_1203081524 -9 Left 1203081521 16_KI270728v1_random:1148050-1148072 CCGCGGCGGCTGCCCGGCTCACC No data
Right 1203081524 16_KI270728v1_random:1148064-1148086 CGGCTCACCCGAGACTCCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203081524 Original CRISPR CGGCTCACCCGAGACTCCGT TGG Intergenic
No off target data available for this crispr