ID: 1203081529

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1148073-1148095
Sequence CGAGACTCCGTTGGCGGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203081516_1203081529 12 Left 1203081516 16_KI270728v1_random:1148038-1148060 CCCGGCCGGGGCCCGCGGCGGCT No data
Right 1203081529 16_KI270728v1_random:1148073-1148095 CGAGACTCCGTTGGCGGCGGCGG No data
1203081518_1203081529 7 Left 1203081518 16_KI270728v1_random:1148043-1148065 CCGGGGCCCGCGGCGGCTGCCCG No data
Right 1203081529 16_KI270728v1_random:1148073-1148095 CGAGACTCCGTTGGCGGCGGCGG No data
1203081506_1203081529 25 Left 1203081506 16_KI270728v1_random:1148025-1148047 CCGCGCCCCCGGCCCCGGCCGGG No data
Right 1203081529 16_KI270728v1_random:1148073-1148095 CGAGACTCCGTTGGCGGCGGCGG No data
1203081520_1203081529 1 Left 1203081520 16_KI270728v1_random:1148049-1148071 CCCGCGGCGGCTGCCCGGCTCAC No data
Right 1203081529 16_KI270728v1_random:1148073-1148095 CGAGACTCCGTTGGCGGCGGCGG No data
1203081517_1203081529 11 Left 1203081517 16_KI270728v1_random:1148039-1148061 CCGGCCGGGGCCCGCGGCGGCTG No data
Right 1203081529 16_KI270728v1_random:1148073-1148095 CGAGACTCCGTTGGCGGCGGCGG No data
1203081509_1203081529 20 Left 1203081509 16_KI270728v1_random:1148030-1148052 CCCCCGGCCCCGGCCGGGGCCCG No data
Right 1203081529 16_KI270728v1_random:1148073-1148095 CGAGACTCCGTTGGCGGCGGCGG No data
1203081521_1203081529 0 Left 1203081521 16_KI270728v1_random:1148050-1148072 CCGCGGCGGCTGCCCGGCTCACC No data
Right 1203081529 16_KI270728v1_random:1148073-1148095 CGAGACTCCGTTGGCGGCGGCGG No data
1203081511_1203081529 18 Left 1203081511 16_KI270728v1_random:1148032-1148054 CCCGGCCCCGGCCGGGGCCCGCG No data
Right 1203081529 16_KI270728v1_random:1148073-1148095 CGAGACTCCGTTGGCGGCGGCGG No data
1203081515_1203081529 13 Left 1203081515 16_KI270728v1_random:1148037-1148059 CCCCGGCCGGGGCCCGCGGCGGC No data
Right 1203081529 16_KI270728v1_random:1148073-1148095 CGAGACTCCGTTGGCGGCGGCGG No data
1203081504_1203081529 26 Left 1203081504 16_KI270728v1_random:1148024-1148046 CCCGCGCCCCCGGCCCCGGCCGG No data
Right 1203081529 16_KI270728v1_random:1148073-1148095 CGAGACTCCGTTGGCGGCGGCGG No data
1203081512_1203081529 17 Left 1203081512 16_KI270728v1_random:1148033-1148055 CCGGCCCCGGCCGGGGCCCGCGG No data
Right 1203081529 16_KI270728v1_random:1148073-1148095 CGAGACTCCGTTGGCGGCGGCGG No data
1203081510_1203081529 19 Left 1203081510 16_KI270728v1_random:1148031-1148053 CCCCGGCCCCGGCCGGGGCCCGC No data
Right 1203081529 16_KI270728v1_random:1148073-1148095 CGAGACTCCGTTGGCGGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203081529 Original CRISPR CGAGACTCCGTTGGCGGCGG CGG Intergenic
No off target data available for this crispr