ID: 1203087241

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1190966-1190988
Sequence CATGGAGGAGGTGCCCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203087241_1203087248 4 Left 1203087241 16_KI270728v1_random:1190966-1190988 CCTCCTGGGGCACCTCCTCCATG No data
Right 1203087248 16_KI270728v1_random:1190993-1191015 CTCAGCATCTGCCAGGAAAGTGG No data
1203087241_1203087246 -3 Left 1203087241 16_KI270728v1_random:1190966-1190988 CCTCCTGGGGCACCTCCTCCATG No data
Right 1203087246 16_KI270728v1_random:1190986-1191008 ATGCCTGCTCAGCATCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203087241 Original CRISPR CATGGAGGAGGTGCCCCAGG AGG (reversed) Intergenic
No off target data available for this crispr