ID: 1203087246

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1190986-1191008
Sequence ATGCCTGCTCAGCATCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203087236_1203087246 27 Left 1203087236 16_KI270728v1_random:1190936-1190958 CCAAGTCACATCACTATGGCAGT No data
Right 1203087246 16_KI270728v1_random:1190986-1191008 ATGCCTGCTCAGCATCTGCCAGG No data
1203087242_1203087246 -6 Left 1203087242 16_KI270728v1_random:1190969-1190991 CCTGGGGCACCTCCTCCATGCCT No data
Right 1203087246 16_KI270728v1_random:1190986-1191008 ATGCCTGCTCAGCATCTGCCAGG No data
1203087241_1203087246 -3 Left 1203087241 16_KI270728v1_random:1190966-1190988 CCTCCTGGGGCACCTCCTCCATG No data
Right 1203087246 16_KI270728v1_random:1190986-1191008 ATGCCTGCTCAGCATCTGCCAGG No data
1203087240_1203087246 -2 Left 1203087240 16_KI270728v1_random:1190965-1190987 CCCTCCTGGGGCACCTCCTCCAT No data
Right 1203087246 16_KI270728v1_random:1190986-1191008 ATGCCTGCTCAGCATCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203087246 Original CRISPR ATGCCTGCTCAGCATCTGCC AGG Intergenic
No off target data available for this crispr