ID: 1203089062

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1201495-1201517
Sequence CTGGCCCCACTGAGGTTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203089052_1203089062 16 Left 1203089052 16_KI270728v1_random:1201456-1201478 CCTGACATCAGGAGGCCCCGGCT No data
Right 1203089062 16_KI270728v1_random:1201495-1201517 CTGGCCCCACTGAGGTTTTGGGG No data
1203089055_1203089062 -1 Left 1203089055 16_KI270728v1_random:1201473-1201495 CCGGCTCTAGTGACTTTCCCTGC No data
Right 1203089062 16_KI270728v1_random:1201495-1201517 CTGGCCCCACTGAGGTTTTGGGG No data
1203089048_1203089062 27 Left 1203089048 16_KI270728v1_random:1201445-1201467 CCAAGGTCTGGCCTGACATCAGG No data
Right 1203089062 16_KI270728v1_random:1201495-1201517 CTGGCCCCACTGAGGTTTTGGGG No data
1203089053_1203089062 1 Left 1203089053 16_KI270728v1_random:1201471-1201493 CCCCGGCTCTAGTGACTTTCCCT No data
Right 1203089062 16_KI270728v1_random:1201495-1201517 CTGGCCCCACTGAGGTTTTGGGG No data
1203089054_1203089062 0 Left 1203089054 16_KI270728v1_random:1201472-1201494 CCCGGCTCTAGTGACTTTCCCTG No data
Right 1203089062 16_KI270728v1_random:1201495-1201517 CTGGCCCCACTGAGGTTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203089062 Original CRISPR CTGGCCCCACTGAGGTTTTG GGG Intergenic
No off target data available for this crispr