ID: 1203090046

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1207808-1207830
Sequence GGACCGTCTCCCTCATCAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203090046_1203090050 3 Left 1203090046 16_KI270728v1_random:1207808-1207830 CCGGCTGATGAGGGAGACGGTCC No data
Right 1203090050 16_KI270728v1_random:1207834-1207856 CCCCAGTGAGCCCAGTCTGATGG No data
1203090046_1203090059 29 Left 1203090046 16_KI270728v1_random:1207808-1207830 CCGGCTGATGAGGGAGACGGTCC No data
Right 1203090059 16_KI270728v1_random:1207860-1207882 AGACACGGGCTCTGTCATCAGGG No data
1203090046_1203090056 14 Left 1203090046 16_KI270728v1_random:1207808-1207830 CCGGCTGATGAGGGAGACGGTCC No data
Right 1203090056 16_KI270728v1_random:1207845-1207867 CCAGTCTGATGGAGGAGACACGG 0: 10
1: 14
2: 27
3: 59
4: 298
1203090046_1203090053 6 Left 1203090046 16_KI270728v1_random:1207808-1207830 CCGGCTGATGAGGGAGACGGTCC No data
Right 1203090053 16_KI270728v1_random:1207837-1207859 CAGTGAGCCCAGTCTGATGGAGG No data
1203090046_1203090057 15 Left 1203090046 16_KI270728v1_random:1207808-1207830 CCGGCTGATGAGGGAGACGGTCC No data
Right 1203090057 16_KI270728v1_random:1207846-1207868 CAGTCTGATGGAGGAGACACGGG No data
1203090046_1203090058 28 Left 1203090046 16_KI270728v1_random:1207808-1207830 CCGGCTGATGAGGGAGACGGTCC No data
Right 1203090058 16_KI270728v1_random:1207859-1207881 GAGACACGGGCTCTGTCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203090046 Original CRISPR GGACCGTCTCCCTCATCAGC CGG (reversed) Intergenic
No off target data available for this crispr