ID: 1203090049

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1207834-1207856
Sequence CCATCAGACTGGGCTCACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203090049_1203090064 20 Left 1203090049 16_KI270728v1_random:1207834-1207856 CCCCAGTGAGCCCAGTCTGATGG No data
Right 1203090064 16_KI270728v1_random:1207877-1207899 TCAGGGCACCCCCCTCTGGGGGG No data
1203090049_1203090060 16 Left 1203090049 16_KI270728v1_random:1207834-1207856 CCCCAGTGAGCCCAGTCTGATGG No data
Right 1203090060 16_KI270728v1_random:1207873-1207895 GTCATCAGGGCACCCCCCTCTGG No data
1203090049_1203090061 17 Left 1203090049 16_KI270728v1_random:1207834-1207856 CCCCAGTGAGCCCAGTCTGATGG No data
Right 1203090061 16_KI270728v1_random:1207874-1207896 TCATCAGGGCACCCCCCTCTGGG No data
1203090049_1203090063 19 Left 1203090049 16_KI270728v1_random:1207834-1207856 CCCCAGTGAGCCCAGTCTGATGG No data
Right 1203090063 16_KI270728v1_random:1207876-1207898 ATCAGGGCACCCCCCTCTGGGGG No data
1203090049_1203090062 18 Left 1203090049 16_KI270728v1_random:1207834-1207856 CCCCAGTGAGCCCAGTCTGATGG No data
Right 1203090062 16_KI270728v1_random:1207875-1207897 CATCAGGGCACCCCCCTCTGGGG No data
1203090049_1203090059 3 Left 1203090049 16_KI270728v1_random:1207834-1207856 CCCCAGTGAGCCCAGTCTGATGG No data
Right 1203090059 16_KI270728v1_random:1207860-1207882 AGACACGGGCTCTGTCATCAGGG No data
1203090049_1203090065 24 Left 1203090049 16_KI270728v1_random:1207834-1207856 CCCCAGTGAGCCCAGTCTGATGG No data
Right 1203090065 16_KI270728v1_random:1207881-1207903 GGCACCCCCCTCTGGGGGGTCGG No data
1203090049_1203090058 2 Left 1203090049 16_KI270728v1_random:1207834-1207856 CCCCAGTGAGCCCAGTCTGATGG No data
Right 1203090058 16_KI270728v1_random:1207859-1207881 GAGACACGGGCTCTGTCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203090049 Original CRISPR CCATCAGACTGGGCTCACTG GGG (reversed) Intergenic