ID: 1203090055

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1207845-1207867
Sequence CCGTGTCTCCTCCATCAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203090055_1203090064 9 Left 1203090055 16_KI270728v1_random:1207845-1207867 CCAGTCTGATGGAGGAGACACGG No data
Right 1203090064 16_KI270728v1_random:1207877-1207899 TCAGGGCACCCCCCTCTGGGGGG No data
1203090055_1203090059 -8 Left 1203090055 16_KI270728v1_random:1207845-1207867 CCAGTCTGATGGAGGAGACACGG No data
Right 1203090059 16_KI270728v1_random:1207860-1207882 AGACACGGGCTCTGTCATCAGGG No data
1203090055_1203090071 30 Left 1203090055 16_KI270728v1_random:1207845-1207867 CCAGTCTGATGGAGGAGACACGG No data
Right 1203090071 16_KI270728v1_random:1207898-1207920 GGTCGGCAGCCCAGCATCCGAGG No data
1203090055_1203090061 6 Left 1203090055 16_KI270728v1_random:1207845-1207867 CCAGTCTGATGGAGGAGACACGG No data
Right 1203090061 16_KI270728v1_random:1207874-1207896 TCATCAGGGCACCCCCCTCTGGG No data
1203090055_1203090063 8 Left 1203090055 16_KI270728v1_random:1207845-1207867 CCAGTCTGATGGAGGAGACACGG No data
Right 1203090063 16_KI270728v1_random:1207876-1207898 ATCAGGGCACCCCCCTCTGGGGG No data
1203090055_1203090065 13 Left 1203090055 16_KI270728v1_random:1207845-1207867 CCAGTCTGATGGAGGAGACACGG No data
Right 1203090065 16_KI270728v1_random:1207881-1207903 GGCACCCCCCTCTGGGGGGTCGG No data
1203090055_1203090060 5 Left 1203090055 16_KI270728v1_random:1207845-1207867 CCAGTCTGATGGAGGAGACACGG No data
Right 1203090060 16_KI270728v1_random:1207873-1207895 GTCATCAGGGCACCCCCCTCTGG No data
1203090055_1203090058 -9 Left 1203090055 16_KI270728v1_random:1207845-1207867 CCAGTCTGATGGAGGAGACACGG No data
Right 1203090058 16_KI270728v1_random:1207859-1207881 GAGACACGGGCTCTGTCATCAGG No data
1203090055_1203090062 7 Left 1203090055 16_KI270728v1_random:1207845-1207867 CCAGTCTGATGGAGGAGACACGG No data
Right 1203090062 16_KI270728v1_random:1207875-1207897 CATCAGGGCACCCCCCTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203090055 Original CRISPR CCGTGTCTCCTCCATCAGAC TGG (reversed) Intergenic
No off target data available for this crispr