ID: 1203090056

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1207845-1207867
Sequence CCAGTCTGATGGAGGAGACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 10, 1: 14, 2: 27, 3: 59, 4: 298}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203090046_1203090056 14 Left 1203090046 16_KI270728v1_random:1207808-1207830 CCGGCTGATGAGGGAGACGGTCC No data
Right 1203090056 16_KI270728v1_random:1207845-1207867 CCAGTCTGATGGAGGAGACACGG 0: 10
1: 14
2: 27
3: 59
4: 298
1203090048_1203090056 -8 Left 1203090048 16_KI270728v1_random:1207830-1207852 CCTGCCCCAGTGAGCCCAGTCTG No data
Right 1203090056 16_KI270728v1_random:1207845-1207867 CCAGTCTGATGGAGGAGACACGG 0: 10
1: 14
2: 27
3: 59
4: 298
1203090045_1203090056 15 Left 1203090045 16_KI270728v1_random:1207807-1207829 CCCGGCTGATGAGGGAGACGGTC No data
Right 1203090056 16_KI270728v1_random:1207845-1207867 CCAGTCTGATGGAGGAGACACGG 0: 10
1: 14
2: 27
3: 59
4: 298
1203090047_1203090056 -7 Left 1203090047 16_KI270728v1_random:1207829-1207851 CCCTGCCCCAGTGAGCCCAGTCT No data
Right 1203090056 16_KI270728v1_random:1207845-1207867 CCAGTCTGATGGAGGAGACACGG 0: 10
1: 14
2: 27
3: 59
4: 298
1203090041_1203090056 26 Left 1203090041 16_KI270728v1_random:1207796-1207818 CCTTAAGAGCACCCGGCTGATGA No data
Right 1203090056 16_KI270728v1_random:1207845-1207867 CCAGTCTGATGGAGGAGACACGG 0: 10
1: 14
2: 27
3: 59
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203090056 Original CRISPR CCAGTCTGATGGAGGAGACA CGG Intergenic
900602186 1:3507692-3507714 CCAGTGGGAGGAAGGAGACAAGG + Intronic
901157511 1:7150378-7150400 CCGCTCTGATGGAGGAAGCAGGG - Intronic
901421679 1:9155405-9155427 CCAGTCAGAGGGAGGAGTCCTGG + Intergenic
901665576 1:10824390-10824412 CTAGCTTGATGGAGGAGACATGG + Intergenic
901799184 1:11697627-11697649 CCAGTCTGAAGGGAGAGACCTGG - Intronic
902378321 1:16040776-16040798 CCGGGCTGATGGAGCAGAGATGG - Intergenic
902379084 1:16044220-16044242 CCAGTCTGCTGCTGGACACAGGG + Intronic
902386416 1:16078416-16078438 CAAGTCTGACAGAAGAGACACGG + Intergenic
902846013 1:19111176-19111198 GCAGGCAGATGGAGAAGACAGGG - Intronic
902874361 1:19331954-19331976 CCAATCTGATGGGGAAGACATGG + Intergenic
902961002 1:19962804-19962826 TCAGTCCACTGGAGGAGACATGG - Intergenic
902976219 1:20090454-20090476 TCAGCCTGATGGAAGAGGCATGG - Intronic
902983926 1:20143953-20143975 ACAGTCTGATGGAGGAGGCATGG - Intronic
903038235 1:20508435-20508457 CCAATCTAATGGCGAAGACATGG - Intergenic
903362285 1:22784133-22784155 CTAATCTGATAAAGGAGACAGGG - Intronic
903812767 1:26044103-26044125 CTAGTCTGATGGGGGAGCCCTGG - Intronic
903933837 1:26880848-26880870 CCAGTCTAATGAAGAAGAAAAGG - Intronic
904038510 1:27571351-27571373 GGAGTCTGATGGGGGAGACCAGG + Intronic
904882615 1:33712225-33712247 CCAGTCTGCAGCAAGAGACATGG - Intronic
905232195 1:36521494-36521516 CCAGTCTGAGGGAGGAGACAGGG - Intergenic
905232205 1:36521534-36521556 CCAGTCTGAGAGGGGAGACAGGG - Intergenic
905232214 1:36521574-36521596 CCAGTCTGAGGGGGGAGACAGGG - Intergenic
905232226 1:36521614-36521636 CCAGTCTGAGGGAGGAGACAGGG - Intergenic
905232236 1:36521654-36521676 CCAGTCTGAGAGGGGAGACAGGG - Intergenic
905232245 1:36521694-36521716 CCAGTCTGAGGAGGGAGACAGGG - Intergenic
905232255 1:36521734-36521756 CCAGTCTGAGGGAGGAGACAGGG - Intergenic
905232265 1:36521774-36521796 CCAGTCTGAGAGGGGAGACAGGG - Intergenic
905232275 1:36521814-36521836 CCAGTCTGAGGGAGGAGACATGG - Intergenic
905232341 1:36522094-36522116 CCAGTCTGAGGGGGGAGACAGGG - Intergenic
905232353 1:36522134-36522156 CCAGTCTGAGGGGGGAGACAGGG - Intergenic
906342618 1:44993988-44994010 CTAGTGTGATAGAGAAGACATGG - Intergenic
907554761 1:55334319-55334341 CCAGCCTGATGCAGGAGTCGTGG + Intergenic
907891739 1:58643207-58643229 CCAGTCTGATGGGAGGGAAATGG - Intergenic
907945362 1:59131170-59131192 CCAGTCTGGTGGAGCTGAAAGGG + Intergenic
910851470 1:91653491-91653513 CAAGTCTGAAGCATGAGACATGG - Intergenic
911505256 1:98741190-98741212 CTAGTGTGATGGATGAAACAGGG + Intronic
912667662 1:111597254-111597276 CCAGTTTGATTGAGGAATCAAGG - Intronic
912728331 1:112078731-112078753 ACAGTCTGATGGAGAAGACTAGG + Intergenic
913197909 1:116473353-116473375 CCTCACTGATGAAGGAGACATGG + Intergenic
915245632 1:154554570-154554592 CCAGTGTAGTAGAGGAGACAGGG - Intronic
917116559 1:171609299-171609321 CTAGTCTCAAGGAGGAGATAGGG - Intergenic
919221050 1:194629159-194629181 CCATTCTGATGGATGTGAGATGG - Intergenic
919774344 1:201184279-201184301 CCAGTCTGATGTAGGAGACATGG + Intergenic
919851120 1:201673634-201673656 CCATTCTGATGTGGGAGAGAGGG + Intronic
919858295 1:201720405-201720427 CCAGATTGATGGAGGTGACGGGG + Intronic
919928249 1:202204119-202204141 CCAGACTGAAGGAGGAGGCATGG - Intronic
919990246 1:202704326-202704348 CCAGGCTGATAGAGGAGACACGG + Intronic
920041151 1:203098349-203098371 CCAGTGTGATGGAGGAGACGAGG - Intronic
920300222 1:204983882-204983904 ACTGTCTCATGGAGGAGATATGG + Intronic
922965793 1:229689757-229689779 CGTGTCCGATGGAGGAGTCATGG + Intergenic
923487978 1:234454697-234454719 CCAGTCTGAAGGATGGGAAAGGG - Intronic
924398922 1:243656401-243656423 ACAGTCTGATGGGGGAGCCTTGG + Intronic
924421772 1:243916757-243916779 CCAGTCAAATGGAGAAGACGTGG - Intergenic
924487294 1:244497839-244497861 CCAGTCTGATGGATGAAAAATGG - Intronic
1064466178 10:15584448-15584470 CCAGTCTGGTGGACAAGAAATGG - Intronic
1066046969 10:31603237-31603259 CCAGGCTGATGGAGCAGGCGAGG - Intergenic
1068627129 10:59261714-59261736 CCAGTCTTAGGGTTGAGACAGGG + Intronic
1072451311 10:95541608-95541630 CCAGTGGGATAGAGGAGCCATGG - Intronic
1072794646 10:98345319-98345341 ACAGTCTAATGGGGGAGGCAGGG - Intergenic
1073056456 10:100706332-100706354 CTAACCTGATGGAGGAGACAAGG - Intergenic
1075431200 10:122383061-122383083 CCAGTCTAATAGATGAGAAATGG + Intronic
1077179387 11:1205455-1205477 CCAGCCTGCTGCTGGAGACATGG - Intergenic
1077249311 11:1554019-1554041 CCAGTCTGAAGGAAGAGGCGCGG + Intergenic
1077539637 11:3140469-3140491 CCAGTCTGAGGGGGAACACAAGG + Intronic
1080081755 11:28228066-28228088 CCAGTATAAGGAAGGAGACAAGG + Intronic
1083180953 11:60984854-60984876 TCAGACTGATGGAGGAGTGAAGG + Intronic
1083681480 11:64353822-64353844 CCAGCCTGAGGGAGGTGACAGGG - Intronic
1083986718 11:66220451-66220473 CCAGCCTGAGGGCGGGGACATGG - Intronic
1084597017 11:70123097-70123119 TCAGTGTAAAGGAGGAGACAGGG + Intronic
1085267185 11:75243827-75243849 CCAGACTGTGGGAGGAGAAATGG + Intergenic
1085277121 11:75307390-75307412 CCAATCTGATGGGGGATCCATGG - Intronic
1085277153 11:75307561-75307583 CTGGTGTGATGGAGGAGGCATGG - Intronic
1085283506 11:75345589-75345611 CCAGTCTGAGGAGGGAGACATGG + Intronic
1086490865 11:87356652-87356674 GCAGTCTGAGGGAGGAGGGAGGG - Intergenic
1086940017 11:92786554-92786576 CCAATCTGATAGATGAGAAACGG - Intronic
1088759258 11:112913659-112913681 ACAGTCTGGTGGGGGAAACAAGG + Intergenic
1089152840 11:116377500-116377522 GCAGGCAGATGGAGGAGAGAGGG - Intergenic
1089631179 11:119785378-119785400 CCAGACAGATGGAGGAAGCAGGG - Intergenic
1090911382 11:131122589-131122611 CCATTCTGAAGGGGGAGAGAGGG + Intergenic
1091386210 12:96995-97017 CCAGTCTGATGGATGAGAAATGG + Intronic
1092719888 12:11431385-11431407 CCAGTCTGCTGGAGGAAAGCAGG + Intronic
1092979390 12:13778457-13778479 CCAGCCTTAGGGAGGGGACAGGG + Intronic
1094476655 12:30845708-30845730 CCAGGGTGGAGGAGGAGACAGGG - Intergenic
1095519491 12:43045775-43045797 CCATTCTGATGGATGTGAGATGG - Intergenic
1096560017 12:52429451-52429473 TCAGTCTGCTGGAGGAGACAGGG - Intronic
1101763476 12:107677949-107677971 GCAGTATGAATGAGGAGACAGGG - Intergenic
1102200206 12:111052880-111052902 TCACTGTGATGGAGGTGACACGG + Intronic
1102467831 12:113140722-113140744 CGAGGATGATGGAGCAGACATGG + Intergenic
1103716648 12:122949131-122949153 CCAGTGACAGGGAGGAGACATGG - Intronic
1103946340 12:124528770-124528792 CTAGCCTGAAGGAGGAGAAAGGG + Intronic
1104226510 12:126839641-126839663 CCAGTCTCATTCAGGATACATGG + Intergenic
1104415844 12:128596179-128596201 CCAGTGTGATGGAGAGAACACGG - Intronic
1104415888 12:128596398-128596420 CCACTGTGATGGAGAAAACACGG - Intronic
1104415932 12:128596616-128596638 CCAGTGTGATGGAGAGGACATGG - Intronic
1106244181 13:27933239-27933261 CCAGTCCAGTGGAGGAGAAAAGG + Intergenic
1107911298 13:45108040-45108062 CCAGAATGAGTGAGGAGACATGG - Intergenic
1108148178 13:47501587-47501609 CGAGGCTGAAGGAGGAGGCAAGG - Intergenic
1108470926 13:50766315-50766337 CCAGGCTGGGTGAGGAGACAAGG - Intronic
1109030021 13:57179515-57179537 CCAGTCTGATGGACCAGAGTGGG - Intergenic
1110341347 13:74394541-74394563 CCAGTCTGATAGGTGAGAAATGG + Intergenic
1110416836 13:75262332-75262354 ATAGGCTGATGGAGGAGAAATGG - Intergenic
1110587726 13:77214134-77214156 CCAGTCTGATGGGTGAGGAATGG - Intronic
1111104046 13:83622580-83622602 CGAGTCTCATGAAGGAGTCAGGG + Intergenic
1111403790 13:87775721-87775743 CCAGTCTGGTGATGAAGACATGG - Intergenic
1113382139 13:109813773-109813795 CCACTATGATGCAGGTGACATGG - Intergenic
1113564567 13:111311836-111311858 ACAGTGTGAGGGAGGAGTCAAGG - Intergenic
1113698927 13:112368547-112368569 CCCGGATGGTGGAGGAGACAAGG + Intergenic
1116430810 14:44843515-44843537 CCAGTTTGAAGGAGGTGGCATGG - Intergenic
1117144645 14:52825274-52825296 CCAGTCTAAGGGAGGAGAACGGG - Intergenic
1117191191 14:53293500-53293522 CCAGCCTCATGGAGGAGTCCAGG - Intergenic
1117526924 14:56618046-56618068 CCAGTGGGGTGGGGGAGACAGGG - Intronic
1118196798 14:63634409-63634431 CTACTCTGAGGGATGAGACAGGG + Intronic
1120682294 14:87494901-87494923 CTAATCTGATGCAGGACACATGG + Intergenic
1120953629 14:90062871-90062893 TCAGTCTAATGAAGGAGACACGG + Intronic
1121865882 14:97362298-97362320 CCAGTTTGCTGGAAGAGTCATGG + Intergenic
1123952666 15:25298058-25298080 CTTGTCTGATGTAGGAGAAAAGG + Intergenic
1125202105 15:37109175-37109197 CAAGTCTGATAGGGAAGACAGGG + Intergenic
1125573563 15:40739497-40739519 ACAGTCTGAGGGTGGAGACATGG + Intronic
1129496395 15:75986076-75986098 CCAATCTGATAGATGAGAAATGG - Intronic
1129711826 15:77824275-77824297 CCAGGCTGATAGTGGAGACATGG - Intergenic
1130832340 15:87614210-87614232 GCAGTCTGATGGAGCAGAAAAGG - Intergenic
1131873477 15:96782506-96782528 CCAGTCAGAGGCAGGAGACAGGG - Intergenic
1132940600 16:2505799-2505821 CCAGGGTGTTGGAGGAGAGAGGG + Intronic
1133160333 16:3907685-3907707 CCAGTTTTAAGGAGGAGCCAAGG + Intergenic
1133829448 16:9308222-9308244 CATGGCTGATGGAGGAGAGATGG + Intergenic
1136105344 16:28026157-28026179 CCAGTCTGTGGGGAGAGACATGG - Intronic
1136687215 16:32002637-32002659 CCGGTCTGATGGAGGAGACACGG + Intergenic
1136881955 16:33907601-33907623 CCAGTCTGATGGAGGAGACACGG - Intergenic
1138460708 16:57146122-57146144 TCAGTGACATGGAGGAGACACGG + Exonic
1138519821 16:57564652-57564674 CCAGAGTGATGGATGAGTCAGGG + Intronic
1139355572 16:66365397-66365419 TCAGGCTGGTGGGGGAGACAGGG - Intergenic
1140397914 16:74645143-74645165 CCAGTCTGATAGATGAAAAATGG - Intronic
1141155240 16:81592720-81592742 CCAGTTCCATGGAGGAGAAAAGG - Intronic
1141655861 16:85416277-85416299 CCAGCCTGCTGGAGGAGGGAGGG + Intergenic
1141876164 16:86826030-86826052 CCAAGCAGATGGAGGAGAGAGGG + Intergenic
1141887116 16:86899739-86899761 ATAGTCTGATGGAGGATATAGGG + Intergenic
1203090056 16_KI270728v1_random:1207845-1207867 CCAGTCTGATGGAGGAGACACGG + Intergenic
1142688862 17:1592876-1592898 CCAGGATGACGGAGGAGACGGGG + Intronic
1144136930 17:12304145-12304167 CCTGTCTGATAGAGGAGAAATGG + Intergenic
1144625308 17:16841370-16841392 CTAGTCTAATGGAGGAGATAGGG - Intergenic
1144881120 17:18431351-18431373 CTAGTCTAATGGAGGAGATAGGG + Intergenic
1145151112 17:20513035-20513057 CTAGTCTAATGGAGGAGATAGGG - Intergenic
1145214861 17:21043399-21043421 CCAGTCCTCTGGAAGAGACAGGG - Intronic
1146162467 17:30567291-30567313 GTAGTCTAATGGAGGAGATAGGG - Intergenic
1146594228 17:34155678-34155700 CCAGTCAGAGGGAGGAGGCCTGG - Intronic
1146649312 17:34597038-34597060 CCTGCCTGAGGGAGGAGGCAGGG - Intronic
1147148193 17:38498306-38498328 CCGGTCTGATGGAGGAGACATGG + Intronic
1147163148 17:38579270-38579292 CTAGTCTGAGGGAGGAGGCAGGG - Intronic
1147164724 17:38587110-38587132 CCAGTCTGAGGGAGGAGGTGAGG - Intronic
1147579462 17:41620069-41620091 CTAGTCTAATGGAGGAGATAGGG - Intronic
1148053189 17:44779298-44779320 CGAATGAGATGGAGGAGACAAGG - Intronic
1148700205 17:49582439-49582461 CTCCACTGATGGAGGAGACAAGG - Intronic
1148700234 17:49582550-49582572 TCAGTCTGATGAGGGAGGCATGG - Intronic
1148757253 17:49980062-49980084 TCAGTCTGATGGTAGAGGCAGGG - Intergenic
1148777848 17:50105602-50105624 CAAGTTTGATGGGAGAGACATGG + Intronic
1148910284 17:50938913-50938935 CCAGTATGTTGGAGGAGGGAAGG - Intergenic
1149599919 17:57886491-57886513 CCAGCCTGAGAGAGGAAACAGGG + Intronic
1149637884 17:58184957-58184979 CTAGTCTGATGGAGGAGGTGAGG + Intergenic
1150414093 17:64973348-64973370 CCAATCTGATGGAGAATGCAAGG + Intergenic
1150797544 17:68250342-68250364 CCAATCTGATGGAGAATGCAAGG - Exonic
1151238136 17:72736509-72736531 CAAGACTGATGGAGGCCACATGG - Intronic
1151435613 17:74094812-74094834 TCAGTCTGACTGATGAGACAAGG + Intergenic
1152534801 17:80944300-80944322 ACAGACTTAAGGAGGAGACATGG - Intronic
1152660553 17:81540035-81540057 CCAGGCTGAGGGAGGAGGCTGGG + Exonic
1153209941 18:2750597-2750619 TCAGTCTAATGTAGGAGACAGGG + Intronic
1155411740 18:25553762-25553784 CCAATCTGATGGGTGAGAAATGG - Intergenic
1155893560 18:31295241-31295263 CATGTCTGATGGAGGAGGTAGGG - Intergenic
1156511409 18:37640038-37640060 CCAGTCTGAAGGGAGAGTCATGG - Intergenic
1156545143 18:37956801-37956823 CCATTGAGATTGAGGAGACAGGG - Intergenic
1160571968 18:79823490-79823512 CCAGTCTCATGGGTGAGAAATGG + Intergenic
1161437747 19:4273674-4273696 CCAGTCTGATGGGGGAGGTATGG - Intergenic
1161437801 19:4273948-4273970 CCAGTCTGATGGAAGAGTTGCGG - Intergenic
1161846093 19:6712790-6712812 CCAGTCTGATGGAGGAGGCAAGG - Intronic
1161846112 19:6712871-6712893 CCAGTCTGATGGGGGAGGCAGGG - Intronic
1161846123 19:6712911-6712933 CCAGTCTGATGAGGGAGGCAGGG - Intronic
1162059418 19:8085789-8085811 CCAGTAAGTTGGAGGAGGCATGG + Intronic
1162515570 19:11145381-11145403 CCTGCCTGAGGGAGGAGAGAGGG - Intronic
1162519807 19:11173193-11173215 CTAGACTGATGGACGAGACGTGG - Intronic
1162519854 19:11173423-11173445 ACAATCTGATGGGGGAGACATGG - Intronic
1162519904 19:11173679-11173701 CCAGTCTGGTGGGGGAGGCACGG - Intronic
1162546854 19:11335953-11335975 CCAGTCTGATGGGGGAGGCATGG + Intronic
1162688345 19:12407061-12407083 CCAGTCTGAGAGAGGAAAAAAGG + Intronic
1163495461 19:17644055-17644077 CCAATCTAATGGAGGAAGCAGGG - Intronic
1163658907 19:18564851-18564873 CCAGCCTGATGGTGGAGAGAGGG - Exonic
1164735927 19:30540889-30540911 CCAGTCTGAGGGAGGGGTCAAGG - Intronic
1166024185 19:40065480-40065502 CCACTCTGAAGAAGGGGACAGGG - Intergenic
1166670499 19:44706904-44706926 CTAATCTGATGGAGGAGACAAGG + Intronic
1166670567 19:44707328-44707350 TCAATCTGATGGAGGAAACAGGG + Intronic
1166670577 19:44707413-44707435 TCAATCTGATGGAGGAGCTATGG + Intronic
1166670598 19:44707522-44707544 CCACTCTGATAGGGGAGACATGG + Intronic
1166670870 19:44708929-44708951 CCAGTCTGAGGGAGGTGACATGG - Intronic
1166670891 19:44709054-44709076 TCAGTCTGATGGAGGAGACCTGG - Intronic
1166670896 19:44709096-44709118 CCAGTCTGACGGAGGAAACATGG - Intronic
1166670904 19:44709138-44709160 CCAGTCTGATGAAGGAGACGTGG - Intronic
1166670912 19:44709180-44709202 CCAGTCTGATGGAGGAGACATGG - Intronic
1166670930 19:44709264-44709286 CCAGTCTGATGGAGGAGACATGG - Intronic
1166670939 19:44709306-44709328 CCAGTCTGATGGAGGAAACATGG - Intronic
1166670948 19:44709348-44709370 CCAGTCTGATGGAGGAGACATGG - Intronic
1166670966 19:44709432-44709454 CCAGTCTGATGAAGGAGACATGG - Intronic
1166670974 19:44709474-44709496 CCAGTCTGATGAAGGAGACATGG - Intronic
1166670982 19:44709516-44709538 CCGGTCTGATGGAGGAGACATGG - Intronic
1166671001 19:44709600-44709622 CCAGTCTGATGGAGGAGACATGG - Intronic
1166671018 19:44709684-44709706 CCAGTCTGATGGAGGAGACATGG - Intronic
1166671027 19:44709726-44709748 CCAGTCTGATGGAGGAGACATGG - Intronic
1166671036 19:44709768-44709790 CCAGTCTGATGGAGGAGACATGG - Intronic
1166671053 19:44709852-44709874 CCAGTCTGATGGAGGAGACATGG - Intronic
1166671070 19:44709936-44709958 TCAGTCAGATGGAGGATACATGG - Intronic
1166673399 19:44724994-44725016 CCAATCTGATGGTGGGGACAAGG - Intergenic
1166676885 19:44746361-44746383 AAGGTCTGAGGGAGGAGACAAGG - Intergenic
925459393 2:4047180-4047202 ACAGTCTGATGCAGGGGGCATGG - Intergenic
926916038 2:17893264-17893286 CCAGGCTGTAGGAGGGGACAGGG - Intronic
928438780 2:31274060-31274082 CCTGTAGGATGGAGCAGACATGG - Intergenic
928941961 2:36735465-36735487 CCACTCTGCTGGAGCAGAGAGGG - Intronic
929411937 2:41706763-41706785 CCAATCTGAGGGAAGTGACATGG + Intergenic
929431709 2:41893038-41893060 CCAGTCTGATGGAAGAGACACGG + Intergenic
930089628 2:47522011-47522033 CTAAACTGATGGAGGAGACATGG + Intronic
932177297 2:69614586-69614608 CCAGAGTGGTGAAGGAGACAGGG - Intronic
932197934 2:69800424-69800446 GCAGACTGTTGGAGAAGACAAGG + Intronic
932432876 2:71686055-71686077 CCTGTCTGATGGAAGAGGCCAGG + Intronic
932435702 2:71701536-71701558 CTAGTCTGATGAGGGAGCCACGG + Intergenic
932457928 2:71861406-71861428 GCTGTCTGATGGGGAAGACAGGG + Intergenic
932556164 2:72826341-72826363 ACAGTCTAGTGGGGGAGACACGG + Intergenic
932753998 2:74392226-74392248 CCAGGCTAATGGAGGAGATATGG - Intergenic
934158594 2:89226691-89226713 GCAGTCTGATGGGGGTGAGATGG - Intergenic
934208678 2:89955736-89955758 GCAGTCTGATGGGGGTGAGATGG + Intergenic
935723162 2:105997498-105997520 ACAATCTGAGGGAGGAGTCAGGG + Intergenic
937094589 2:119227136-119227158 CGAATCTGAGTGAGGAGACACGG + Intronic
938068962 2:128298124-128298146 CCAGTCTGATGGATGTGAAGTGG - Intronic
938116956 2:128608681-128608703 CCCGACTGATGGAGGAGGCAAGG + Intergenic
941067921 2:160924302-160924324 GCAGTCTGATGGAGGATGCCGGG - Intergenic
942900348 2:181109368-181109390 CCACTCTGATGGCTGAGACATGG + Intergenic
944636716 2:201681974-201681996 CCAGTCTGATGGGGAAGAAGAGG + Intronic
944903613 2:204240710-204240732 CCAGTCTCACGGAGGAGATACGG + Intergenic
945180395 2:207085524-207085546 CCAGTCAGATGGTGAAGAAATGG + Intronic
945422439 2:209656029-209656051 CCACTCTAATGAAGGAGAAAAGG - Intronic
945884740 2:215363435-215363457 CAATTCTGATGGAGGAGAATTGG - Intronic
946319328 2:218941383-218941405 CCATTCTGATGGATGTGAGATGG + Intergenic
946814234 2:223559421-223559443 CCAGTCTGATGGACAAAACTTGG - Intergenic
948088601 2:235271506-235271528 CCAATCTGATGGGTGAGAAATGG - Intergenic
948834426 2:240619206-240619228 CCTGACTAATGGAGGAGAAATGG + Intronic
1169143748 20:3239601-3239623 CCGGTCGAAAGGAGGAGACAGGG - Intergenic
1170317465 20:15058152-15058174 TCAAGCTAATGGAGGAGACATGG - Intronic
1170563034 20:17573699-17573721 CCAGTCTGATGGTTGTGAAATGG + Intronic
1170854525 20:20038957-20038979 GCAGTCTGGTGGAGGAGCCGAGG + Intronic
1171724499 20:28603404-28603426 CCTGTCTGATGGAGGAAACAGGG + Intergenic
1171753562 20:29079656-29079678 CCTGTCTGCTGGAGGAAACAGGG - Intergenic
1171788694 20:29497906-29497928 CCTGTCTGCTGGAGGAAACAGGG + Intergenic
1171858838 20:30376594-30376616 CCTGTCTGATGGAGGAAACAGGG - Intergenic
1172055204 20:32149987-32150009 CCTCATTGATGGAGGAGACATGG - Intronic
1172634163 20:36398459-36398481 TCAGTCTGGTGGAGGTGGCAGGG + Intronic
1172639652 20:36433045-36433067 TCAGTCTGATGGGGGTGGCAGGG - Intronic
1174356021 20:49998355-49998377 GCAGACTGAGGGAGGAGACAAGG + Intergenic
1175871611 20:62211928-62211950 CCCTTCTGTTGCAGGAGACAGGG - Intergenic
1176725994 21:10432868-10432890 CCAGGCTGTTGAAGGAGAGAGGG + Intergenic
1177384218 21:20388316-20388338 CCATTCTGAGGGAGGAGCAAAGG - Intergenic
1180288380 22:10774245-10774267 CCAGGCTGTTGAAGGAGAGAGGG - Intergenic
1180298048 22:10962078-10962100 CCTGTCTGATGGAGGAAACAGGG + Intergenic
1180410363 22:12601720-12601742 CCTGTCTGATGGAGGAAACAGGG - Intergenic
1180884929 22:19235547-19235569 TCAATATGAAGGAGGAGACATGG + Intronic
1182240389 22:28911377-28911399 CCATGCTGCTGGAGGACACAGGG - Intronic
1182800459 22:33028190-33028212 CCAGTGTGCTGGAGGGGAAAGGG - Intronic
1183073420 22:35411891-35411913 CCAGTCTGAGGGTGGGGAAAGGG - Intronic
1183465221 22:37976890-37976912 CCATTCTGACAGAGGAGACATGG - Intronic
1183520902 22:38295516-38295538 CCAGTCTCCTGGGAGAGACATGG - Intronic
1184337084 22:43860272-43860294 TCAGTCTGATGGGGGAGACATGG - Intronic
1184741203 22:46429994-46430016 CCAGGCTGGTGGAGCAGTCAGGG - Intronic
1184782800 22:46657550-46657572 CCAGGCAGAGGGAGGAGGCAGGG - Intronic
949099930 3:131592-131614 CCATTCTGACGGTGGAGAAATGG + Intergenic
950432614 3:12959474-12959496 CCTGTCTGATGGAGGAGTCACGG + Intronic
950941946 3:16901688-16901710 ACAGGCTGATGGGGGAAACACGG - Intronic
951727231 3:25774001-25774023 CTACTCTGATGGAGGTGGCAGGG + Intronic
951908700 3:27728382-27728404 CCAGTCCGATGGGGGAGGCCAGG + Intergenic
952201463 3:31132835-31132857 CTACTCTGATGGGGGAGAGAAGG + Intergenic
952251080 3:31655164-31655186 GCAGCATGATGGAGGAGACAAGG + Intergenic
953006405 3:38983255-38983277 CCACTCTGGTGAAGGTGACATGG - Intergenic
953124633 3:40078835-40078857 CCGTTCTGCTGAAGGAGACAGGG + Intronic
953784495 3:45900737-45900759 CCTGTCTGATGGCAGAGGCATGG - Intronic
953883189 3:46701885-46701907 CCAGACTGATGGGGGATACTGGG + Intronic
954187520 3:48929705-48929727 CAAGAATGATGGAGGAGATAAGG - Intronic
955380144 3:58431876-58431898 CCAGTATGATGGGGCATACAAGG - Exonic
955752691 3:62198550-62198572 CCAGTCTGAGAGAGGATCCATGG - Intronic
959268276 3:104171504-104171526 CCAGTCACATGCTGGAGACAGGG + Intergenic
960004809 3:112771078-112771100 CCACTCTCATGGAGGAGATGAGG - Intronic
962447841 3:135484064-135484086 CCAGTCAGAGGTGGGAGACATGG - Intergenic
964594224 3:158404829-158404851 CCAGTTTGAGGGAGGACAAATGG - Intronic
968826454 4:2901289-2901311 TCAGTGTGAGGGAGGAGAGAGGG + Intronic
969319392 4:6402627-6402649 CCAGTCTCATGGGGCAGTCATGG + Intronic
969861537 4:10039673-10039695 CCAGCCTGCTGGAGAAGACAAGG - Intronic
972298164 4:37760187-37760209 CATGTCTGCTGGAGAAGACAGGG - Intergenic
974084402 4:57244104-57244126 AAAGTCTGAGAGAGGAGACAGGG - Intergenic
975168805 4:71209339-71209361 ACAGTCTACTGGGGGAGACAGGG + Intronic
975640665 4:76496700-76496722 GCAGTTTGATGTAGTAGACAGGG + Intronic
976211616 4:82676976-82676998 ACAGTCTCATGGAAGAGAGAAGG - Intronic
976562725 4:86520998-86521020 CCGGTCTGGTGGAGGTGGCAAGG + Intronic
977351497 4:95894334-95894356 CCAGTGTCATGGAAGGGACAAGG + Intergenic
977624910 4:99179655-99179677 CTAGTCTGATGGGGGTGCCAGGG + Intergenic
978854821 4:113382323-113382345 CCACTCTGAGGGAGGGGAGAAGG + Exonic
980980156 4:139647928-139647950 ATAGTCTGCTGGAGGAGACAGGG - Intergenic
981196674 4:141929161-141929183 AGAGTCTGGTGGAGGAGACAGGG - Intergenic
985436981 4:189940262-189940284 CCTGTCTGATGGAGGAAACAGGG - Intergenic
986340149 5:6781960-6781982 CCATGCTGATGGCTGAGACAGGG + Intergenic
989172547 5:38487104-38487126 CCAGTCTAGTGCAGGAGGCAAGG - Intronic
989666128 5:43856692-43856714 CCAGTTAGATGGAGGAGTCTGGG - Intergenic
990639214 5:57762617-57762639 CCACCTTCATGGAGGAGACATGG + Intergenic
992099064 5:73388981-73389003 CCAGTGTTGTGAAGGAGACAAGG + Intergenic
992504708 5:77375573-77375595 CCTGGCTGATGGAGGGGAGATGG - Intronic
994671228 5:102764012-102764034 CCAGTCTGGTGGTGGATACTGGG + Intronic
996652816 5:125901640-125901662 ACAACATGATGGAGGAGACACGG + Intergenic
997349213 5:133218300-133218322 CCAGGGTGATGGAGCAGAAATGG - Intronic
997771753 5:136561491-136561513 CCAGCCTGAGGAAGAAGACAGGG - Intergenic
999331404 5:150675996-150676018 CCAGTGTCCTGGAGGAGAAATGG + Intronic
999628458 5:153544743-153544765 CTAGTAAGATGGAAGAGACATGG + Intronic
1000702162 5:164466218-164466240 TCAGTCTAATAGAGGAGGCAAGG - Intergenic
1001104621 5:168842707-168842729 GCAGTCTGAGGGAGAAGAGAGGG - Intronic
1001167880 5:169387489-169387511 CCAGTCTGATGGATGAGAAATGG + Intergenic
1001465910 5:171965984-171966006 CCACGCTGATGCAGGAGAGAGGG - Intronic
1001882889 5:175259953-175259975 CCAGTCTGGTGGAGGAAAGGAGG - Intergenic
1002276570 5:178107915-178107937 CCAGCCTGAGGGAGGAGAGCTGG - Intergenic
1003709354 6:8571782-8571804 CCAGTCTGAGGGAGAAGCCCAGG + Intergenic
1003977161 6:11355158-11355180 GAAGTCAGATAGAGGAGACATGG + Intronic
1006292876 6:33153690-33153712 CCAGTCAGCTGAAGGAGAAAGGG - Intergenic
1006373055 6:33657208-33657230 CCAGTCTGATGGAGGGGACAGGG + Intronic
1006586316 6:35116620-35116642 GCTTTCTCATGGAGGAGACAGGG - Intergenic
1006939496 6:37742513-37742535 CCAGTCTGTTGGGGCAGGCAGGG + Intergenic
1007282177 6:40720821-40720843 CAAGTCAGATGGAGGAGGCCAGG + Intergenic
1007415790 6:41690570-41690592 CCAGTCTAATGGCAGAGGCAGGG - Intronic
1007723749 6:43901610-43901632 ACCGTCTGAGGGAGGAGACATGG + Intergenic
1010466326 6:76171078-76171100 CCATTCTGATGGATGTGAGATGG - Intergenic
1010990901 6:82479072-82479094 CTAGTCTGATGGGGGAGAAATGG + Intergenic
1015227658 6:130876038-130876060 GGAGTCTAGTGGAGGAGACATGG - Intronic
1015579211 6:134705160-134705182 CCAGGCTGATGGGGGAGGCAGGG - Intergenic
1016985143 6:149889457-149889479 CCAGTAAGATCAAGGAGACATGG - Exonic
1017375190 6:153760589-153760611 CAACTCTAATGGAGGTGACAGGG - Intergenic
1017775699 6:157679291-157679313 CCCGTGTCATGGAGGAGAGAAGG - Intergenic
1017775708 6:157679322-157679344 CCCGTGTCATGGAGGAGAGAAGG - Intergenic
1017775716 6:157679353-157679375 CCAGGGTCATGGAGGAGAGAAGG - Intergenic
1017982603 6:159414385-159414407 CCAGTCCGATGGAGCAGCTAAGG - Intergenic
1018975602 6:168562942-168562964 CCAGTGAGATGGAGGGAACAGGG - Intronic
1020221426 7:6241371-6241393 CCAGTCTGATGGGTCAGAAATGG - Intronic
1021015209 7:15523675-15523697 CCTGTCTGGTGGTGGAGTCAAGG + Intronic
1022895170 7:34742844-34742866 CCATTCTGATGGATGTGAGATGG + Intronic
1023057213 7:36299989-36300011 CCAGGCTGGTGAAGGAGGCAGGG - Exonic
1025276027 7:57581531-57581553 CCAGGCTGAAGGAGGAGAAGGGG + Intergenic
1025607292 7:63048380-63048402 GCAGTGTGATGGAGGAGGCAAGG - Intergenic
1026472130 7:70702707-70702729 CCAGGCTGATGGAGGTGAGGTGG - Intronic
1026772713 7:73212449-73212471 TCAGTCCCATGGAGGTGACAAGG + Intergenic
1027013577 7:74765849-74765871 TCAGTCCCATGGAGGTGACAAGG + Intergenic
1027050633 7:75019266-75019288 CTAGTCTGAGGTGGGAGACATGG + Intronic
1027050650 7:75019338-75019360 CTAGTCTGATGGGGGACACATGG + Intronic
1027074461 7:75180184-75180206 TCAGTCCCATGGAGGTGACAAGG - Intergenic
1027593078 7:80138811-80138833 CCAAGCTGAAGAAGGAGACAAGG - Intronic
1027800903 7:82747748-82747770 CCAGTCTGAGGAAGGAGAAATGG + Intergenic
1028954540 7:96674191-96674213 ACAGTCTAGTGGTGGAGACAAGG - Intronic
1029235256 7:99110545-99110567 CCAGTCTGATAGGTGAGAGATGG - Intronic
1029382353 7:100222152-100222174 ATAGTCTGAAGGGGGAGACACGG - Intronic
1029382362 7:100222188-100222210 CTAGTCTGAGGTGGGAGACATGG - Intronic
1029382378 7:100222260-100222282 CTAGTCTGATGGGGGAGACACGG - Intronic
1029382396 7:100222332-100222354 CTAGTCTGAGGTGGGAGACATGG - Intronic
1029382421 7:100222440-100222462 CTAGTCTGAGCGGGGAGACATGG - Intronic
1029637866 7:101797140-101797162 CCTGTCTGTTGCAGGAAACAGGG + Intergenic
1029920298 7:104255307-104255329 GCAGTCTAATGGAGGAGACCAGG - Intergenic
1030463728 7:109873629-109873651 CCACTAAGTTGGAGGAGACAGGG - Intergenic
1031084580 7:117289907-117289929 CCGGGATGATGGAGGTGACAAGG + Intronic
1032085432 7:128881081-128881103 ACATTCTGAGGGGGGAGACATGG + Exonic
1033195258 7:139321893-139321915 CCAGGCTGGAGGAGGAGAGAGGG + Intergenic
1034611927 7:152379017-152379039 CCAGGCTGTTGAAGGAGAGAGGG - Intronic
1036777637 8:11624646-11624668 GCAGTGTGATGGGGGAGGCAAGG + Intergenic
1036810144 8:11862298-11862320 CAAGGCTGATGGAAGATACAAGG + Intronic
1037421495 8:18708083-18708105 CCAGTCTGATCCTGGAGACAGGG + Intronic
1040106770 8:43546108-43546130 CCACCCTGATGTGGGAGACAGGG + Intergenic
1042612063 8:70609950-70609972 CCAGTCTGTTGGGGTAGGCAAGG - Intronic
1043196207 8:77295526-77295548 ACAGTCTGATGAAGGTAACAAGG - Intergenic
1043718336 8:83511352-83511374 CCACTCTGGTGGAGGTGGCAGGG + Intergenic
1047758137 8:127934351-127934373 CCAGTCTGGTGGTGGTGACTGGG + Intergenic
1047908192 8:129495352-129495374 CCGGACTATTGGAGGAGACAAGG + Intergenic
1048675785 8:136778108-136778130 CCAGTGTGATGAATGGGACACGG - Intergenic
1049042984 8:140126265-140126287 CCAGGCTGGAAGAGGAGACACGG + Intronic
1049048905 8:140176000-140176022 AGAGTCTGATGGAAGAGACAGGG + Intronic
1049671979 8:143873941-143873963 CCAGGCTGAGGCAGGAGACCAGG - Intronic
1051759189 9:20442183-20442205 CCAATCTGATGGATGAAAAATGG - Intronic
1052818900 9:33123648-33123670 CCAGTCCTATGGTAGAGACATGG - Intronic
1053131744 9:35619246-35619268 CCTGGCTGATGGAGGAGAGAGGG + Intronic
1053310321 9:37014221-37014243 CCAGTCTGATCCAAGACACATGG - Intronic
1053528217 9:38851247-38851269 CCAGTGTGATCCAGGAGACTGGG - Intergenic
1053725110 9:40991778-40991800 CCTGTCTGATGGAGGAAACAGGG - Intergenic
1054200438 9:62075680-62075702 CCAGTGTGATCCAGGAGACTGGG - Intergenic
1054340858 9:63860215-63860237 CCTGTCTGATGGAGGAAACAGGG + Intergenic
1054637917 9:67512681-67512703 CCAGTGTGATCCAGGAGACTGGG + Intergenic
1056286473 9:85092345-85092367 CCAGTCTGGTGTGAGAGACAAGG - Intergenic
1056714878 9:89020782-89020804 CACTGCTGATGGAGGAGACATGG - Intronic
1058021430 9:100093834-100093856 TCAGTCTGATGGGTGAGAAATGG - Intronic
1059026016 9:110630898-110630920 TCACTCTGATGGATGAGAAATGG + Intergenic
1059542606 9:115144864-115144886 ACAGTTTCAAGGAGGAGACAGGG - Intronic
1059790526 9:117637221-117637243 CCAGGCTGAAGGAGTAGATAAGG - Intergenic
1059883926 9:118723281-118723303 CCATTCTGATGGGTGAGAGATGG + Intergenic
1060912564 9:127362575-127362597 CCAGTCTGGCAGAGCAGACACGG + Intronic
1062243968 9:135553875-135553897 CCAGCCTGAGAGAGGAGAGAGGG + Intergenic
1203449706 Un_GL000219v1:100211-100233 CCTGTCTGATGGAGGAAACAGGG + Intergenic
1186106526 X:6213249-6213271 CCAGTCTGATGTTTTAGACAGGG - Intronic
1186826627 X:13346716-13346738 CAAGCCTGATGGAGGATCCAGGG + Intergenic
1189177390 X:38971606-38971628 CCAGGCTGCTGCAGAAGACATGG + Intergenic
1190540728 X:51475263-51475285 CCATTCTCATGGACTAGACAGGG - Intergenic
1191707248 X:64106043-64106065 TCAGTCAGATGCAGGAGAAAAGG + Intergenic
1195084545 X:101401883-101401905 CCAGGCTGGGGGAAGAGACAAGG + Intronic
1195544422 X:106099572-106099594 CCAGTCATATGGAGGAAAGAAGG + Intergenic
1196794278 X:119489744-119489766 CCAATCTGATGGAAGAGAAAAGG + Intergenic
1198383474 X:136105530-136105552 CCAGGCAGATGGAGGGGAGAAGG + Intergenic
1198836895 X:140815334-140815356 CTGCTCTGATGGAGGAGGCAGGG + Intergenic