ID: 1203090057

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1207846-1207868
Sequence CAGTCTGATGGAGGAGACAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203090048_1203090057 -7 Left 1203090048 16_KI270728v1_random:1207830-1207852 CCTGCCCCAGTGAGCCCAGTCTG No data
Right 1203090057 16_KI270728v1_random:1207846-1207868 CAGTCTGATGGAGGAGACACGGG No data
1203090047_1203090057 -6 Left 1203090047 16_KI270728v1_random:1207829-1207851 CCCTGCCCCAGTGAGCCCAGTCT No data
Right 1203090057 16_KI270728v1_random:1207846-1207868 CAGTCTGATGGAGGAGACACGGG No data
1203090045_1203090057 16 Left 1203090045 16_KI270728v1_random:1207807-1207829 CCCGGCTGATGAGGGAGACGGTC No data
Right 1203090057 16_KI270728v1_random:1207846-1207868 CAGTCTGATGGAGGAGACACGGG No data
1203090046_1203090057 15 Left 1203090046 16_KI270728v1_random:1207808-1207830 CCGGCTGATGAGGGAGACGGTCC No data
Right 1203090057 16_KI270728v1_random:1207846-1207868 CAGTCTGATGGAGGAGACACGGG No data
1203090041_1203090057 27 Left 1203090041 16_KI270728v1_random:1207796-1207818 CCTTAAGAGCACCCGGCTGATGA No data
Right 1203090057 16_KI270728v1_random:1207846-1207868 CAGTCTGATGGAGGAGACACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203090057 Original CRISPR CAGTCTGATGGAGGAGACAC GGG Intergenic
No off target data available for this crispr