ID: 1203090058

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1207859-1207881
Sequence GAGACACGGGCTCTGTCATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203090048_1203090058 6 Left 1203090048 16_KI270728v1_random:1207830-1207852 CCTGCCCCAGTGAGCCCAGTCTG No data
Right 1203090058 16_KI270728v1_random:1207859-1207881 GAGACACGGGCTCTGTCATCAGG No data
1203090046_1203090058 28 Left 1203090046 16_KI270728v1_random:1207808-1207830 CCGGCTGATGAGGGAGACGGTCC No data
Right 1203090058 16_KI270728v1_random:1207859-1207881 GAGACACGGGCTCTGTCATCAGG No data
1203090051_1203090058 1 Left 1203090051 16_KI270728v1_random:1207835-1207857 CCCAGTGAGCCCAGTCTGATGGA No data
Right 1203090058 16_KI270728v1_random:1207859-1207881 GAGACACGGGCTCTGTCATCAGG No data
1203090055_1203090058 -9 Left 1203090055 16_KI270728v1_random:1207845-1207867 CCAGTCTGATGGAGGAGACACGG No data
Right 1203090058 16_KI270728v1_random:1207859-1207881 GAGACACGGGCTCTGTCATCAGG No data
1203090045_1203090058 29 Left 1203090045 16_KI270728v1_random:1207807-1207829 CCCGGCTGATGAGGGAGACGGTC No data
Right 1203090058 16_KI270728v1_random:1207859-1207881 GAGACACGGGCTCTGTCATCAGG No data
1203090049_1203090058 2 Left 1203090049 16_KI270728v1_random:1207834-1207856 CCCCAGTGAGCCCAGTCTGATGG No data
Right 1203090058 16_KI270728v1_random:1207859-1207881 GAGACACGGGCTCTGTCATCAGG No data
1203090054_1203090058 -8 Left 1203090054 16_KI270728v1_random:1207844-1207866 CCCAGTCTGATGGAGGAGACACG No data
Right 1203090058 16_KI270728v1_random:1207859-1207881 GAGACACGGGCTCTGTCATCAGG No data
1203090047_1203090058 7 Left 1203090047 16_KI270728v1_random:1207829-1207851 CCCTGCCCCAGTGAGCCCAGTCT No data
Right 1203090058 16_KI270728v1_random:1207859-1207881 GAGACACGGGCTCTGTCATCAGG No data
1203090052_1203090058 0 Left 1203090052 16_KI270728v1_random:1207836-1207858 CCAGTGAGCCCAGTCTGATGGAG No data
Right 1203090058 16_KI270728v1_random:1207859-1207881 GAGACACGGGCTCTGTCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203090058 Original CRISPR GAGACACGGGCTCTGTCATC AGG Intergenic
No off target data available for this crispr