ID: 1203090064

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1207877-1207899
Sequence TCAGGGCACCCCCCTCTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203090049_1203090064 20 Left 1203090049 16_KI270728v1_random:1207834-1207856 CCCCAGTGAGCCCAGTCTGATGG No data
Right 1203090064 16_KI270728v1_random:1207877-1207899 TCAGGGCACCCCCCTCTGGGGGG No data
1203090047_1203090064 25 Left 1203090047 16_KI270728v1_random:1207829-1207851 CCCTGCCCCAGTGAGCCCAGTCT No data
Right 1203090064 16_KI270728v1_random:1207877-1207899 TCAGGGCACCCCCCTCTGGGGGG No data
1203090048_1203090064 24 Left 1203090048 16_KI270728v1_random:1207830-1207852 CCTGCCCCAGTGAGCCCAGTCTG No data
Right 1203090064 16_KI270728v1_random:1207877-1207899 TCAGGGCACCCCCCTCTGGGGGG No data
1203090055_1203090064 9 Left 1203090055 16_KI270728v1_random:1207845-1207867 CCAGTCTGATGGAGGAGACACGG No data
Right 1203090064 16_KI270728v1_random:1207877-1207899 TCAGGGCACCCCCCTCTGGGGGG No data
1203090052_1203090064 18 Left 1203090052 16_KI270728v1_random:1207836-1207858 CCAGTGAGCCCAGTCTGATGGAG No data
Right 1203090064 16_KI270728v1_random:1207877-1207899 TCAGGGCACCCCCCTCTGGGGGG No data
1203090054_1203090064 10 Left 1203090054 16_KI270728v1_random:1207844-1207866 CCCAGTCTGATGGAGGAGACACG No data
Right 1203090064 16_KI270728v1_random:1207877-1207899 TCAGGGCACCCCCCTCTGGGGGG No data
1203090051_1203090064 19 Left 1203090051 16_KI270728v1_random:1207835-1207857 CCCAGTGAGCCCAGTCTGATGGA No data
Right 1203090064 16_KI270728v1_random:1207877-1207899 TCAGGGCACCCCCCTCTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203090064 Original CRISPR TCAGGGCACCCCCCTCTGGG GGG Intergenic
No off target data available for this crispr