ID: 1203093246

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1229860-1229882
Sequence GTTCCTGCACATTTATGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203093246_1203093256 24 Left 1203093246 16_KI270728v1_random:1229860-1229882 CCGGCCCATAAATGTGCAGGAAC No data
Right 1203093256 16_KI270728v1_random:1229907-1229929 CCACTGGGCTTCCCCCGAGCAGG No data
1203093246_1203093252 8 Left 1203093246 16_KI270728v1_random:1229860-1229882 CCGGCCCATAAATGTGCAGGAAC No data
Right 1203093252 16_KI270728v1_random:1229891-1229913 AAGAAAGATGCAAATCCCACTGG No data
1203093246_1203093257 27 Left 1203093246 16_KI270728v1_random:1229860-1229882 CCGGCCCATAAATGTGCAGGAAC No data
Right 1203093257 16_KI270728v1_random:1229910-1229932 CTGGGCTTCCCCCGAGCAGGTGG No data
1203093246_1203093259 29 Left 1203093246 16_KI270728v1_random:1229860-1229882 CCGGCCCATAAATGTGCAGGAAC No data
Right 1203093259 16_KI270728v1_random:1229912-1229934 GGGCTTCCCCCGAGCAGGTGGGG No data
1203093246_1203093258 28 Left 1203093246 16_KI270728v1_random:1229860-1229882 CCGGCCCATAAATGTGCAGGAAC No data
Right 1203093258 16_KI270728v1_random:1229911-1229933 TGGGCTTCCCCCGAGCAGGTGGG No data
1203093246_1203093253 9 Left 1203093246 16_KI270728v1_random:1229860-1229882 CCGGCCCATAAATGTGCAGGAAC No data
Right 1203093253 16_KI270728v1_random:1229892-1229914 AGAAAGATGCAAATCCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203093246 Original CRISPR GTTCCTGCACATTTATGGGC CGG (reversed) Intergenic