ID: 1203093251

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1229882-1229904
Sequence TTTGCATCTTTCTTTCCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203093251_1203093261 12 Left 1203093251 16_KI270728v1_random:1229882-1229904 CCAAAGGGAAAGAAAGATGCAAA No data
Right 1203093261 16_KI270728v1_random:1229917-1229939 TCCCCCGAGCAGGTGGGGCAGGG No data
1203093251_1203093256 2 Left 1203093251 16_KI270728v1_random:1229882-1229904 CCAAAGGGAAAGAAAGATGCAAA No data
Right 1203093256 16_KI270728v1_random:1229907-1229929 CCACTGGGCTTCCCCCGAGCAGG No data
1203093251_1203093259 7 Left 1203093251 16_KI270728v1_random:1229882-1229904 CCAAAGGGAAAGAAAGATGCAAA No data
Right 1203093259 16_KI270728v1_random:1229912-1229934 GGGCTTCCCCCGAGCAGGTGGGG No data
1203093251_1203093266 19 Left 1203093251 16_KI270728v1_random:1229882-1229904 CCAAAGGGAAAGAAAGATGCAAA No data
Right 1203093266 16_KI270728v1_random:1229924-1229946 AGCAGGTGGGGCAGGGCCCGTGG No data
1203093251_1203093260 11 Left 1203093251 16_KI270728v1_random:1229882-1229904 CCAAAGGGAAAGAAAGATGCAAA No data
Right 1203093260 16_KI270728v1_random:1229916-1229938 TTCCCCCGAGCAGGTGGGGCAGG No data
1203093251_1203093257 5 Left 1203093251 16_KI270728v1_random:1229882-1229904 CCAAAGGGAAAGAAAGATGCAAA No data
Right 1203093257 16_KI270728v1_random:1229910-1229932 CTGGGCTTCCCCCGAGCAGGTGG No data
1203093251_1203093258 6 Left 1203093251 16_KI270728v1_random:1229882-1229904 CCAAAGGGAAAGAAAGATGCAAA No data
Right 1203093258 16_KI270728v1_random:1229911-1229933 TGGGCTTCCCCCGAGCAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203093251 Original CRISPR TTTGCATCTTTCTTTCCCTT TGG (reversed) Intergenic