ID: 1203093258

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1229911-1229933
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203093248_1203093258 23 Left 1203093248 16_KI270728v1_random:1229865-1229887 CCATAAATGTGCAGGAACCAAAG No data
Right 1203093258 16_KI270728v1_random:1229911-1229933 TGGGCTTCCCCCGAGCAGGTGGG No data
1203093246_1203093258 28 Left 1203093246 16_KI270728v1_random:1229860-1229882 CCGGCCCATAAATGTGCAGGAAC No data
Right 1203093258 16_KI270728v1_random:1229911-1229933 TGGGCTTCCCCCGAGCAGGTGGG No data
1203093247_1203093258 24 Left 1203093247 16_KI270728v1_random:1229864-1229886 CCCATAAATGTGCAGGAACCAAA No data
Right 1203093258 16_KI270728v1_random:1229911-1229933 TGGGCTTCCCCCGAGCAGGTGGG No data
1203093245_1203093258 29 Left 1203093245 16_KI270728v1_random:1229859-1229881 CCCGGCCCATAAATGTGCAGGAA No data
Right 1203093258 16_KI270728v1_random:1229911-1229933 TGGGCTTCCCCCGAGCAGGTGGG No data
1203093251_1203093258 6 Left 1203093251 16_KI270728v1_random:1229882-1229904 CCAAAGGGAAAGAAAGATGCAAA No data
Right 1203093258 16_KI270728v1_random:1229911-1229933 TGGGCTTCCCCCGAGCAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203093258 Original CRISPR TGGGCTTCCCCCGAGCAGGT GGG Intergenic