ID: 1203096941

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1267110-1267132
Sequence TCTCCATTTCAGGGAGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203096941_1203096948 7 Left 1203096941 16_KI270728v1_random:1267110-1267132 CCCTGCCCTCCCTGAAATGGAGA No data
Right 1203096948 16_KI270728v1_random:1267140-1267162 GACAGATGAGCAATGCCGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203096941 Original CRISPR TCTCCATTTCAGGGAGGGCA GGG (reversed) Intergenic
No off target data available for this crispr