ID: 1203098703

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1287287-1287309
Sequence TTGTCCTAGATGAACTTGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203098700_1203098703 6 Left 1203098700 16_KI270728v1_random:1287258-1287280 CCTGTCATCACTTCTCTAGGTCA No data
Right 1203098703 16_KI270728v1_random:1287287-1287309 TTGTCCTAGATGAACTTGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203098703 Original CRISPR TTGTCCTAGATGAACTTGGT CGG Intergenic
No off target data available for this crispr