ID: 1203111540

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1452893-1452915
Sequence CCAAGGAAGGCTTTGTGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203111540_1203111548 17 Left 1203111540 16_KI270728v1_random:1452893-1452915 CCATATCACAAAGCCTTCCTTGG No data
Right 1203111548 16_KI270728v1_random:1452933-1452955 TGCCTGCAATTCCAGCACTTTGG 0: 113
1: 6522
2: 106509
3: 241665
4: 244348
1203111540_1203111552 27 Left 1203111540 16_KI270728v1_random:1452893-1452915 CCATATCACAAAGCCTTCCTTGG No data
Right 1203111552 16_KI270728v1_random:1452943-1452965 TCCAGCACTTTGGGAGGCTGAGG 0: 4261
1: 95514
2: 216800
3: 242347
4: 268001
1203111540_1203111551 21 Left 1203111540 16_KI270728v1_random:1452893-1452915 CCATATCACAAAGCCTTCCTTGG No data
Right 1203111551 16_KI270728v1_random:1452937-1452959 TGCAATTCCAGCACTTTGGGAGG 0: 228
1: 17611
2: 315017
3: 263798
4: 149065
1203111540_1203111549 18 Left 1203111540 16_KI270728v1_random:1452893-1452915 CCATATCACAAAGCCTTCCTTGG No data
Right 1203111549 16_KI270728v1_random:1452934-1452956 GCCTGCAATTCCAGCACTTTGGG 0: 157
1: 12624
2: 239438
3: 275156
4: 180926
1203111540_1203111546 -10 Left 1203111540 16_KI270728v1_random:1452893-1452915 CCATATCACAAAGCCTTCCTTGG No data
Right 1203111546 16_KI270728v1_random:1452906-1452928 CCTTCCTTGGCTGGGTGTGGTGG No data
1203111540_1203111554 30 Left 1203111540 16_KI270728v1_random:1452893-1452915 CCATATCACAAAGCCTTCCTTGG No data
Right 1203111554 16_KI270728v1_random:1452946-1452968 AGCACTTTGGGAGGCTGAGGTGG 0: 60215
1: 147830
2: 155736
3: 113395
4: 79914

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203111540 Original CRISPR CCAAGGAAGGCTTTGTGATA TGG (reversed) Intergenic
No off target data available for this crispr