ID: 1203111717

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1454247-1454269
Sequence GCCCCCTTTATCCCCCTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203111717_1203111719 25 Left 1203111717 16_KI270728v1_random:1454247-1454269 CCCTTAAGGGGGATAAAGGGGGC No data
Right 1203111719 16_KI270728v1_random:1454295-1454317 TCTGTCTGTCTCTCTCTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203111717 Original CRISPR GCCCCCTTTATCCCCCTTAA GGG (reversed) Intergenic
No off target data available for this crispr