ID: 1203116026

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1491305-1491327
Sequence AACACTGAGGTACCCAGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203116026_1203116029 -5 Left 1203116026 16_KI270728v1_random:1491305-1491327 CCTTGTCTGGGTACCTCAGTGTT No data
Right 1203116029 16_KI270728v1_random:1491323-1491345 GTGTTCGCATGAGGCATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203116026 Original CRISPR AACACTGAGGTACCCAGACA AGG (reversed) Intergenic
No off target data available for this crispr