ID: 1203124769

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1563953-1563975
Sequence CAGAGGACAGTGAAGTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203124769_1203124775 29 Left 1203124769 16_KI270728v1_random:1563953-1563975 CCTGGCCACTTCACTGTCCTCTG No data
Right 1203124775 16_KI270728v1_random:1564005-1564027 CAAGACTCTAGTTAATTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203124769 Original CRISPR CAGAGGACAGTGAAGTGGCC AGG (reversed) Intergenic
No off target data available for this crispr