ID: 1203127920

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1608706-1608728
Sequence TATAATGCAAAATCACCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203127919_1203127920 -3 Left 1203127919 16_KI270728v1_random:1608686-1608708 CCTAGTCTGATACTATACATTAT No data
Right 1203127920 16_KI270728v1_random:1608706-1608728 TATAATGCAAAATCACCTAAAGG No data
1203127918_1203127920 -2 Left 1203127918 16_KI270728v1_random:1608685-1608707 CCCTAGTCTGATACTATACATTA No data
Right 1203127920 16_KI270728v1_random:1608706-1608728 TATAATGCAAAATCACCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203127920 Original CRISPR TATAATGCAAAATCACCTAA AGG Intergenic
No off target data available for this crispr