ID: 1203132664

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1701013-1701035
Sequence AAACATGAACAAATGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203132655_1203132664 14 Left 1203132655 16_KI270728v1_random:1700976-1700998 CCACTGGCCCCTAGCTAGAGGTG No data
Right 1203132664 16_KI270728v1_random:1701013-1701035 AAACATGAACAAATGGAGCTGGG No data
1203132654_1203132664 15 Left 1203132654 16_KI270728v1_random:1700975-1700997 CCCACTGGCCCCTAGCTAGAGGT No data
Right 1203132664 16_KI270728v1_random:1701013-1701035 AAACATGAACAAATGGAGCTGGG No data
1203132652_1203132664 28 Left 1203132652 16_KI270728v1_random:1700962-1700984 CCATGGAGCTGTTCCCACTGGCC No data
Right 1203132664 16_KI270728v1_random:1701013-1701035 AAACATGAACAAATGGAGCTGGG No data
1203132658_1203132664 7 Left 1203132658 16_KI270728v1_random:1700983-1701005 CCCCTAGCTAGAGGTGGGTGTAG No data
Right 1203132664 16_KI270728v1_random:1701013-1701035 AAACATGAACAAATGGAGCTGGG No data
1203132661_1203132664 5 Left 1203132661 16_KI270728v1_random:1700985-1701007 CCTAGCTAGAGGTGGGTGTAGGA No data
Right 1203132664 16_KI270728v1_random:1701013-1701035 AAACATGAACAAATGGAGCTGGG No data
1203132659_1203132664 6 Left 1203132659 16_KI270728v1_random:1700984-1701006 CCCTAGCTAGAGGTGGGTGTAGG No data
Right 1203132664 16_KI270728v1_random:1701013-1701035 AAACATGAACAAATGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203132664 Original CRISPR AAACATGAACAAATGGAGCT GGG Intergenic
No off target data available for this crispr